Description :
From Genome Similarity Track
Location :
Scaffold_93:117510- 120008
Transcript NameFunction/comments
Hyaar_Emoy2809051formin-homology 2 domain-containing protein
Hyaar_Emoy2809052hypothetical protein

Sequence
2498 bases(100 bases per row)
GCTGTGTCACTGAGCTACTAATGATGCTATTGCCTCCATTTCCAAATCGGTGCGTGCCCTTAGTATCCAGAGGAAGCGACGAACGGACTATTGAACCATC
AGGTGAAAGAGACGCCGGCTCTCGATCGACGGGGGACGGCGGTGCACTCCTGCTCGCTAACAGACGCGTATCGTCTTTGCCTTTACGTGCAGACAACCGC
CTTCCACCAAGGGTCTTCAAAGAATCTAGTTTGGAAATAGGGGTTCCTGGACACATATCCCGCCCAGCAACTGGTGATCCAGAGGACCGGCTGCTCAGAA
CTGGTGAGGGAGTGCTCCTTGTAGCGTACCTGCTTACTACCGGTGACGGAGTCGCTGGAAAACCAGGCACTGGAGATGGAACCCCATAAAAGCCTTCCTC
GACCGACGCGGCAGCAGCAGAACTAGCGAGCGGATACTTTGTACGCTGAACAGCGAGCGATTTCGCCCGAATTTCTTCAAAGTAGCCAGCCATCTTAAGC
GCCATAAAGTCGGAACGAATCGCTAGTCGATCTTCAAGCCGAATGGCTTTATTCACAATGATATTCACAAAACTTAACACGTCTTCCTTGAATACCAGGG
AGTATCTTGTTGATTTGAGCGCATCTCGCAAACAACTGAAGCGGATATTCTCGCCTTTCGTTTCCTTATAGTGATCGAACGCTTCAATGACAGCAGTGTG
CCCGGCCGCGCTGTTGTAGCACACAATTCCAAGCAGCTGTAGCGTATACTTCTTCACGTCTCCATTCTCCGTATGGAAACAGAGAGCCACCCGCTTCACT
AGTCCAGGTGTATTGGTGATTGCTTCCACCCCAGCAGTAAAATGAGTCAGTGAGCGCAAAATCCGCAAAATTACCTCGCACACGCGCGTAGCTTTCTCAT
ACTTCGAGTGTTCGATAGGAAACGGAGATGGATCAGGAAGCTTCATCGTAAGGTAATCCAAACCAAAATGAGCCAGGAAAGACTCAAGCCAGTCAGTCGA
TGCAATCGAGATTTTGCCACGAAGCGCCTCGAGATCCTTCAGACCCTTGTTATCCCACCTTAATTCCACCAGGTTATCTGCAAACCTTTTCGCTTCCGTT
GCATTCGACTTTGTGTTGTCTTCATTCTCATTTTGCTGGGCGTACCAAACGACGTGCCACTTGGTTTCCAGTGATTCGATGCGAACAAGCTCATCCATGA
CGTCCTCGGGCACTCCACGCTTCGACATTAACTCGCGGTACATCTCGTCTACGGTTTCCCACCTCTGCGGCTTGGGCGGCTTCTCCTTCTCCCTGGGTGC
CGTACCGCCAGTGGGTATCCGCGTAGCAAAGAAACCACGAAAGTACTGCAGTTTCTCGTTAAAATTTCCATCCTGGACCGGATTCGACATGGAAATGGAC
GACCGAAAGAAGCTGTTGCGTCGTGGCTTGGACGACGATGACGACAGAGCTGCGTAACTGCTGCTCTCGAGTTTCTCTGACTCACGCCGAAACTCCATCG
ATAGCGGCCACGCCGTCGGGTCCTTTTGCAGCTGTATAGCGTACTTGACAATCTGTTCAAACGGCATATCGTCAATTGCCGTCTTATGAAGCATCTGCAG
GATGTCACCCGTCTTAACGCGTCCTGTCGACTCGACATATCCAAGCTTTCCTCCTTTAAGCGGCCGGAACCCCTTCACCACAGCTCCGCGCTGAGGTTTG
TCCCGTTCAATGTGTCGCGCCCGCAGGTCGAGACCGAGCGGTCCCGGTGTCGGCACTTCAAGGCCAAAGACAAGCGCACGGTCGTTCGCATTCGGGTCGC
TACTAAAGAAGGGACTGGCCATCGACATGGACGAGCGCAACGGCGTGGTACTGAGCGGTGCAGATGCCATTAAGTTCGGGGACTCTCGCGCGACGCTGGG
ATTGTTATTACTGCAGCTAAAGCTGCTGCTGTTGTTGTTATTGTTTCCTCCATTCAGCGAGCCTCGACGCTTGCGCCACATGGACACCAGACTCTAGTCG
CTCAGATGATCAAGCGCGTCTGTGCGTGCGGTCGTTCTTCTCGAGTGGCAGAGAGAGAGTGCGGGCGCTTGCACCGATGGGCGAGTCAGGAGCTATCTGT
CTGATCGACGTCGGCGGGCAGTGGCACACTGTACCGTCGCTTTGCTCATGTACACCACGCGAAGAACCCTTCGCAGCTGAGTCCGACGCTCTGTACCCAG
GTGCTCTTTTTCTACCAATCATAAGCAGCCTCGACCAGCGCAACCGCTGCTGACTCCTCGTCATTATTCAAAACGCAACGCAAAGAACGAAACCCCTTGG
CTGCGTCTCCTGCGTCTGCGTCTCTTGCGTCTGTTCTACTACCACCGCTAGTTACTGCGACCTCCATCGCTACCATCATGTGTATCTTGTGCTCGAGCGA
GCCTGTGGAAGGCGATGTGCGCAAGAACAACCCCGGCGCGTTCCACGTGGGCATGATGAAGGCCCCGGGCGCCGACCCCATGTGTACGTCGAGCCATG