Description :
From Genome Similarity Track
Location :
Scaffold_299:11750- 13717
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_299-fgenesh-gene-0.0TRNA uridine 5-carboxymethylaminomethyl modification enzyme gidA

Sequence
1967 bases(100 bases per row)
TACGACGTCGTGGTGGTCGGcGGTGGCCACGCTGGGTGTGAGGCGGCGGCGGCTGCGGCACGAGCCGGTGCCtGCACTGCCCTGGTGACGCAGAAGCTCT
CGACGGTCGGCGAGATGTCGTGCAACGTACGCTCGTTTGCTTGTGTCTGCGTAaTGATGATACTAACTGTAGTTCTGTAGCCATCgaTCGGTGGTGTTGG
TAAGGGCACGCTCGTGCGTGAGGTGGACGCACTCGATGGTCTCATGGGCAAGaTCGCGGATCAAGCcGGTATCCAGTTTCGCATGCTCAACTCGGCTAAA
GGTCCTGCTGTGCGTGGCCCTCGGGCGCAGATGGACCGCGATATCTATCAACACACTATGCAGCAAACGCTGCGAGAGATCCCGAACcTAACGCTCGAGG
AAGAAGGCGTCGAGGATCTCGTGCTGTGCCCGATCCAGAACCAAATCGAAGGCATTGTCACGGCATCCGGCCGTACTATTCGATGCTCCAAAGTTGTGgT
CACGACGGGCACATTCCTCCGCGGTATGATCTATCTCGGCCGAGACATTCGATTCCCAGCCGGTCGCCACATGCGCGACTGCAATGGGTTAGAACCGCCA
TCGATTGGACTCGCAAAGACGCTTGAGCGCTTTGAGTTtCcACTTGGACGACTCAAGACAGGCACGCCGCCTCGGCTCGACGGCAATACGATCAACTACG
AAGGGCTTGAGATTCAGCCCAGTGATGAtCcGGCCATGCCATTCTCGTTCCTCCATGAaAACCAAAGAGTACCTCTTGCCGACAAGCAAGTTGTCTGCcA
TGCAACGTACACCAACGAGAAGACCcACCAGATCGTGCGAGACAACTTGCATTTGCTGCCCGAGTACATTGGTGGTGGTGGGCTTGGAGTCGGCCCACGC
TACTGTCCGTCGATCGATGCCAAGGTGTTGCGGTTTGCAGACCGCAATCGCCATCAGATTTGGCTTGAACCGGAAGGATTGAACACGTCGATTGTCTATC
CGAATGGCATCAGCACGGCCTTGCCAGAGGACTTGCAGGTTCAGCTGCTGCGCACCATCCAAGGCCTCGAGAACGTCGACCTCATCCGCCCAGGGTACGC
AGTTGAGTACGACTTCATCGACCCACGTTCGCTTCACCCAACTCTTGAGACAAAGAAAATCAACGGCCTGTATCTCGCTGGCCAGATTAACGGTACGACT
GGGTACGAAGAGGCCGCCGCGCAGGGTGTGGTCGCCGGCATGAACGCCGGCCTGGCTGCCGTTGGTAAGGCGCCTTTCGTGCTAGACCGCGCAGACGCGT
TCATtGGTGTGCTGATCGACGATCTCGTCTCACTTGGGACAAACGAGCCGTACCGCATGTTCACGTCGCGTTCCGAATACCGGTTGCTACTCCGCCAAGA
CAACGCGGATCTCCGTCTCACACGCCGTGCATTTGAGCATGGTGCTGGTGTGGGTGATGGTCGAATGGAACGATTGGAGAAGAAAGAAGTGGCGATGGCA
CGTGCTCGCAAGGCTCTCGAGGACTTCTCGTGCGATCCACATCAGTGGAACAAGTACGGAGTCAAGGTTGGCCTCGATGGTGTCAAGCGAACAGCGGCAC
AGATCTTGTCGTTTGCGCACGTGACACCCAAGGACATCGAAGAGATCTGGCGTAAGGAAGAGTATCAGTACGCGGATGCGCTGCCCGATGAAATCAAGGA
GTTGATGAAGATTGAGTGCTTGTACGCGACTCAACTCCGGTTGCAGAAGCAGGAGATCGACGCATTCCGCAAGAAaCAGCACGTGCCTATTCCCGAGTGG
ATCGATTACGCCTCGCTCCCCATGATCTCGAATGAGGAGAAAGAGAAGCTTCAGAAGGCCAAGCCGACGACGATCCATGCTGCTAGTCGTATTGCCGGTA
TCCGCTCTGCCACACTGCTGTTGCTGTACCAaTACGCCATGCGCAGGGAGTACGACCCcGAGTACAA