Description :
From Genome Similarity Track
Location :
Scaffold_176:11748- 13491
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15654Hypothetical protein
Sappa_CBS223.65SPRG_15655Hypothetical protein

Sequence
1743 bases(100 bases per row)
TGTATTTCGCTTTGCCAGCTTCCGGTCACTTCGTCCGCGCCAAGATATGACGTATTGTATAAAAAATGATTTTACTAAGAACATATTCTTATACTAGTAC
AGTATTCAACTACAGCACACCAAGAACGACTTCGTGTGTAGTGGTTGACTACTAGTACCTGCAACAACAACGCCCTATGACGCACTTCTCGTATGTGATA
ATGTAAACGTTTGCATTTACTTGCTAATAAAACCTGCGATTGCCGCATCGATTTGCTGGTGGGCCCAGACGAGCGACGGCAAGTCGTCCTTGGACGGCGC
GTTCATGTCACCGCAGTGCGACGTGTCTTCAATAAAGACGACCTTGGACGTCGGGTTCTTGGGCTGCGTCTGGTTGTGGTAGTCGAGTGCCGACCACGGG
TCGATGGTACCGCCGGACCAGATGACGTTGCCGACGTCGATGTCGAGACCGTGAAAGTCAGCGCGCTTGGCGGCGATGCGGGCGTCCGCGTCCGTGATGC
CAAAGACGTCCTTGCGCATTTGGTAGTAGACACGGTCGGCGGTCACATATTTGAGCTCGGAAAACGGTCCCGTACTCTTGGCAGCGGTCTGGCCAAAGCC
AAACTCGTTGCAGGTCTGCCACGTCCACTGGCGGTAGATGCCCACCGTGTCGGTCGTCGTGCCCGAGATCACGTCGACCCAGTCGGCCTGGTAGTTAGAG
CCGGTGCAGTTGTTGGTCGCCGAGAAGCTGCGCGCGTTGATCTTGGCGACCTTCTCGAGCGCCGAGAGACCGTTGGCTGCCGTGAGGTCGGCGCACGCCG
CCTTGAGGCCGTACGGCAGATGATCGTTGGACTGCGCGAGGTTCTGGTACGCGCCCATGATGTTGGCCTCGATGTCCATCTTATCAAGGTCCGTCTTCAT
CGGCGAGCACGGGTTAAACAGCTTTTGCAGCGTCGCGACGTCGTCCGGCTGGTCGCTGGCGACAAGCGCGTGGAACTGTTTGAGGCCTTCCGCGAGCGTG
TTCGTGCAGGCGTCGCCGCCGAGCGTGTTGAGGCCGCGCGCGACAACGCTCATGTACTCGTGAAAGTCGGCCTTGATGTCGATGGGCGCCGAGCTCGCAA
TCGAGCCGGCAAAGCGCGTCGGGAACTTGAACTTGGCCCAAGCTGCGAGCATACCGGGGTAGCTGCCTCCAAAGGCGACCCACGGCGACGACGCCGGGAT
GCTGCGGTTCGCTGCAAAGTAGTCCTGGAAGGTCGCGAGATCCGCGAGCGCTTGGTCGGACGTGTGGAAGGCGAGGTTGGCCGTCGACATGCCCGATGTC
GGCTGCGATTTGCCGTAAAAGCGGTGTTCGAGCGCGACAAGGAGCGCGCCGTACTTCTTGGCGGCCGCGACGATGTACATGCCAGTGCTGGTGATGTAGC
CGGGCGTCGCGACGTTCTCACCATGAATGTACAAAAAGACTGGCGAGCCGGCGCCCTTGTAGTAAGCGTCGTTGACGTGGTAGCGCTGCTTCCAGTACGT
GGGCGCGCCGCACTTGTCGTGGGTGTGGTCAAGGACCTGTTTCTCAAACCACTGGTCCGGAAGCGGCGCGGCCGTGTCCTCGAGGTGGTTATTGCGCTCA
AACTTCTGGAGGTTCTTGAGGATCGTGTTCTCCTTGACAAAGAGCGGGCACAAGTACCCGACGCGATTTGCCGGCTCGATTGCGAGCTCGGCGCCGATCG
ACATCAAGGCCGACTACTTTGAGTACATGAACGTTGTCGCGAG