Description :
From Genome Similarity Track
Location :
Scaffold_43:117452- 119518
Transcript NameFunction/comments
Hyaar_Emoy2805837hypothetical protein

Sequence
2066 bases(100 bases per row)
GTCGGGATCACCGCCCCAATCACTGTCGCTAAATCTGTCGATGACGATTTGGCTTGTATTTCCATATTGACACTGGTAGTTGATACCGTAATTCATTGTG
CTTGCAAGATAGCAAAATACTCGCTTCACTGCTCCAACATGCTTATGGCTCGGTTGATTCACGAACCGACTGAGCAAACCGACTGCAAAGGATACGTCTG
GTCGAGTCGACGTGGCTAGGTACATCAGTGAACCAACTGCCTCTCGATACGGAAATGACACCATGTTGTCATCTGTCTTTAGTTCCTCATGCACGAGTCG
CGTGGTACAATCCACTGGATTGCCTACTTTGCGTGCTTCCAAGAACCCAAATCTCTCCAGCACTTCACGTATATACTGTGTCTGTCGTAGAGTGAAGCTT
GCGTCATTATGATCGATTTCAACACCATGACACTGAGACACTTGGCCGTGATCTTTAATTCCATACTGCTCATCCAGTAACTGAATAGATTATTCTTTTG
CTCGAATGCCTTAGTAGCTGCTAGTAGATCGTCGACGTAAACCAATATCAGGCACACCACTCCGTTCTTCCAAGGTACGTACAGACACGGCTCTGTGTGT
CCATGCTTAAATTCTCGCGCCTCAAGAAAGCGATCAATTTCTATGTTCCACTCCCGTCCAGCCTGCCGCAAACCACACAGCACTTTCTTCACTTTGAATG
CCTTATTACTCGCATTGACATGTCCTTGAATGCGATTGACGTACTGTGGAATTTGTAGATTCTCATTCTGTATTGACATCACACCTGTAGATATCCAGTC
CCAATGAGGCTGACAATGCTACAAATAACCGAAATGACGCCATGCGAGCTACCGGTGCAAATGTGTTAACAAAGTCAACACCGACGCGTTGCTTGTCTCC
GCGAGCAACTAGCCGTGCTTAGAATCGAACCACTTCTCCTTGCTCATTAGTCTTTACTGCATAAACCCACATCGTTGTCAACACATTGATCGAAGTTGGC
ACGTCCTCCGAGGATATTTCCTCAAGCACTTCTTTAGTCTTCAGTGCTTCAATCTCTTGTAACTCCGCGTCATGCCTCTTGCGTGCATATCCAGACTTTA
GTGTTTCCGCATGGTTTTTCGGTATCTTGACCATGCTTTTTAATAGTCCTTTGTATCCGTCATCAAAGTTACTTATGGTTGCATGAACGACGAAATCGTT
GAAACGCGATGGCATTCGACGCTGACTCGTACTCCTCAAATTTTCACGTAGCTTCTTCACTTTCACGTCACCAGTCATACTTCCTGTTGATGACATCTGT
GCACGCTTGCGCTTCGTCGGTTCCACTTGAACGGCTAGTTCCGCCGCGCGACAAACATTTTTTATGTCAATGTCTTCATCACTTTCAACTGATCCTTGTT
CGCCATCGATTGAGCCGATATGTGAGCTTGTATGGGATTGACCAGCGTTGGTCATCACCGATGTTTCTTCCATCAACTCGCCAGGTTCATCGATGTTGCT
GCTCGTACAGTTTGATTCACTAGAGCCACCAGCTTCATTGATATTGCTGTGGACAGAGTCGGATGCATCACGATCATCGACTGGCACTGCCCAAACACTG
TCTTGCGCAACCTCGTCTTGTGCATTTGTTATGGTGTTTTCAATGATTTCTGCGTCTTCACGAATGATGTCTTCAAGAATGCTGTCCTGTGCTTCGGTAT
CAATAACGTATTTGCCGTCCTCGATGCTTGCATCGACATCGCTGTCGTTGTCCGGGGATGTGTATGCGGTAGTGTGTCGATCACGATAAAGAACTTACTC
ATTTACGCGAATGTCAGGTACAAATTTTCGCGTACTTCCATCGGGAAAGTAGAGCTTGCAACCCAAAACGTAGCGATATTGGCGTTACGGTTTAGCTTGT
GACGCCGTGCGTCGGCTTTGACATGCGCATACGCCAAAGAGCCAAATGTGCGAAGATGATGAATGTCTGGCCGCTAGCCAAACGTCTTTTCATACGGTGT
ACTATTACAGCCTCGAGTAAACGTTCGGTTCTTGATGTAAACCGAGTATTGAAACGCATCGGTCCA