Description :
From Genome Similarity Track
Location :
Scaffold_756:11744- 12782
Transcript NameFunction/comments
Phypl_g10783hypothetical protein

Sequence
1038 bases(100 bases per row)
CCGCCGCCAAGatgcagcacgacgaagTGATCTGGAGCGTCATCTCCAAGCAGTTCTGCTCCTACAAGAGCAAGTACGTGCGGCGCTTTGCCACTTTTTG
CCGCTGGCAATTCATAACTTGTCAACCGGACTGACAAACTGGTCATTGCCACCGCTTTTTTTGCCACAGACTGCCGGGCACAGGCAACATGTTCTGCAGC
AACCCGTACAACGTGACGGGCCTGTGCAACCGGTCGGCGTGCCCGCTGGCCAACAGCCGCTACGCCACCATccgcgaggaggacggcgtgTGCTTCCTGT
ACATGAAGACGATCGAGCGCGCGCACACGCCCAACCGGCTGTGGGAGCGCGTGAAGCTGAGCAAGAACTACAGCAAGTCGCTGGCGCAGATCgacaagca
gctgcagttctggcccaagaagctcgtgcacAAGAACAAGCAGCGGCTCACCAAGATCCACCAGTACCTCATGCGCATGCGCAAGCTCACACTCAAGACC
AAGCCCAAGCTCGTGGTCATCAACAAGAAGATCGACCGCCGCGAGAAAcgccgcgagaagaaggccatggtggccgccaagctcgacaactcgatcgaga
aggagctgctcgagcgcctgcagAAGGGCACCTACGGCGATATTTATAATTTCCCCGAGCGCGAGTTctccaaggtgctggccgacaagGGCAAGCGCCA
Gaccatggaggaggagagcgaggacgaggacgaggtcgagtacgagctcgacggagacgaggacgacgacgcggaggaggacgaagacgacgaggacgtc
gGACAGATCGAGTACGTCGAGGACtttgacgaggacgagagcgaccTCGAGGACCTCGCGGACGAGTtcgcggtggacgacgatggagacaGCGCCGAGT
CCGACAGCGAAGAGGAGGACACTGCCAcgtccaagaagcgcaaggcgcCCGCgcccgccaagaaggacagcaagaagcagaagaagcccaagggACCGTA
CGTCGAGATCGAGTACGaacaggagcaggaggcggcca