Description :
From Genome Similarity Track
Location :
contig_76:117427- 149591
Transcript NameFunction/comments
g11869.t1hypothetical protein
g11870.t1POM73472.1 Hsc70 cochaperone [Phytophthora palmivora var. palmivora
g11871.t1KUF78052.1 Mitochondrial acidic protein mam33 [Phytophthora nicotianae
g11872.t1RAW40520.1 hypothetical protein PC110_g3277 [Phytophthora cactorum
g11873.t1hypothetical protein
g11874.t1hypothetical protein
g11875.t1XP_008903452.1 hypothetical protein PPTG_22598 [Phytophthora parasitica INRA-310
g11876.t1hypothetical protein
g11877.t1XP_009514115.1 phospholipase D-like protein [Phytophthora sojae
g11878.t1RAW40493.1 hypothetical protein PC110_g3285 [Phytophthora cactorum
g11879.t1POM62124.1 Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family [Phytophthora palmivora var. palmivora
g11880.t1XP_008903391.1 hypothetical protein PPTG_10447 [Phytophthora parasitica INRA-310

Sequence
32164 bases(100 bases per row)
TCCGTCATGATGCACTTTGTTTTGACCAATTACAGAGCTGAGTTTATTTGGCGAATCAGAATAACTCGCTGGTTTTGTCGAATCAGCGTCGGCTTATGCT
GACCAGTCAGCCTACTGTACTTGACATACAAACATCAAGTCAAACGTCAAACCGCTCGCGACCACTGCCTCACCCCGTTCACTATCGATTTTGCTTTGTG
GACGAGAGTTGAATGATAAGCGGTTTTGTGCATTATTATAGCGTTTACAGCGCTGGCGATGGAGTGAAGATACCTAACGTTACATAGTGATAGGAGCGAG
GACCGTTTTGGTCTCTCCTCCTTCTGTGAGCATTACACTTTGTCATAGTTACACTGACCATCCGCCAACCCACCAAATATCTGTATATTCCAGTAGTGAT
CGAGCGTATATTGTGCTGCGAGTGGTCGATGCTGAAGAGCGACGATATTTTTCCAGCCAACCTACCCCACAGCACCAACACTGGCCCCCACGACAGTTGT
TCTGTTGAGAATACCCCAGAAGTGACTTCACTCGATCACTCGTTGTACTGGTGCGCAGTTTTCAAGCCTGGAGAGTGATGAAGCGAAACACAGTACCAAC
ACTGCGACCGGGGTGCAGTTGTTCTGACTGTCAACGACCGTATCTGACTCCTTCGAATCCTATGGCATAGTGCTATAGGATGTTAGATCAAGTTGTGAAT
GGGTGTAGTGTGCAGCCTCTCCGCAGAACTGATGATTTATCAAGCCCTTGTTTTTTTTTTTTCAAGGGCAGTACCAACTATCTTTTCCAGGAGACCGTTC
TGTTGAGACCACAGAAATGAAATACACCAGTTTTGGAGTTTTGATCATATCCCAAGGCCAACATCGATTATCATCGGGGGCTACGTGTAGTTGTGTTGAA
ATTCAGTGGCTCACGTGCCTCAATCAATTGTTGTAACGTGGAGAATTTGATCTAATGCCCCATGCCTGAGCTAGTACTTCGACTGGAATGTGGCTGCCAC
GAGGTAAAAGTGCCGGATCGAACCAGCGACGCTTTCTTCATAAGGTGACCTTGGTGAATTCTTGGCAGCAAGCTGAAAAAGTTCCAGCCTTCAAGGATAC
ACGTGACTCCACTCGTCCCGGCCTCAGCGCGCACAACGCGCACTCCTTGCAGATGCCGAGCGCACAAGTCGTAGAACTCAAGCAGCAGATATTCCGTGCT
TTTCTCCTCGGGTGCTTCGGGAATATTGTTGGTAGAATGATTTGGGTCATGTTGAATATGACTGTGCCGTGCTGTTAGCTTTGGTGTCTCGGACACTCTC
GACGTTGGTGGGTTCTTCATTGCTGCTGCCGCGAAAGGTGCGAGGGTAAATTCGTTTGAAGACCCTGTTGGCCGCAGTGTATGGTGCCCTAGCACCTGGC
GAGCTGCACCAGCCATAGCATAGCTAGTATCAGCAAATTCAGCTCGCAACGAGTCTCCTTTAGCTTTCCACTCGCCAGCAAGTCCTCCTGGGGTCTCTAG
CACGTGGGTGAGTAGTTCAAGCCACTGTGGTGATAAGACACTGCGAAGCCACTGGTTCTCCCGAAGTGCGGCCCCCAAGTTTGTAAACGCCCACGCTGAG
CTCAGCTGTTGCGAGTGTCTGAGCGCGTAGGCGACACGATGAAGCGACTTGATCAGCAAATGCTGGCTGCTCTCAGCGTTAGAGCTTTCGCTTTGAGAAT
TATGCAGATTGTCGTGCTGATTATTTGGCTGTGTTGATGCCGATTGACGTCGTTGGTTCAGCACCACCGACTTCTTTTTCTTCTGCTCACGCTCGGCCTT
GACTTGTGCGATATACTCCGCGTCCTCGCGTTCATGAGCCAGGTCCGCTTCGAGTTGATACGCGACCTGGGAGATAATTTGAGCCCACGCCTGCCGATTC
AGCCGCAGGTCCATTTGAGTTCGACAGGACCAATGGGAACCAAGATTGAGATTCTTGGCTACCAAGAGGGCCTCAAGTGAATGGCTGCACAACCAGCGCA
GCGAAAATCGCTGCAAAAGGTGGTCAAACTGCATGGACGACGGCAAACCTAGCGACTGCATCACATGATACAAATCCATCTCTCCAGTGAACAGGATCAC
CAGTCGAACTACTGGCGATGACGGTCCAGGAGTTCCACTGCTTGATGGCCCCATGCGTAACTGGGGTTTCGTCGGTAGTGTAACAAACCAACGGTGGAAG
AACGGTAGCGACTCGATATGATCGCGAAAAAAATCGCCCAAGAACCATGTTAAACGATCGACTAGAATTTGAGCGTCGCTGTCTACAGTAAGATAGCCAC
ATACAAACTAATTAGATTTTTCCTGTACGGTTGCCAGTACCAGCAAATGTACCAACCTTTCGTGCCACTCCGACAGGCGAAGTCGATGTACATGAAGCAT
TCTGCACCACGCTCCAGATATTTCAACTCGTGGAGTGTGGCAGCAGCTGCACATTGCATAGTGTATCTGGTTAGGTCAGCTCCCAACTCAAACAACAAAA
ATCACTTACAGTCAGCGTCCGAGTTGTAAGTGAGATGAACGGTAGCGGTTGTAGAAAACTTGTGCCCTACGTCAACTTTCACCATATAGTCGCCTCGATC
GCCGCCAGGAGTGCGAGACAGCAGACAACTCGCAGACAGCAGCCCTGTGGCCGCTGCTTGGCGCACATGTTTAAATATCCATTGAACTCGTTGCTTGAGT
CGTCTCAATGCGCAGAAGGAATGCAAACGGCACTGCAAAAAGAATCTACGCCAGCGCTTCACCACACCCACGTCTCTATCAGCACAGAACCAGCTTCCAA
GTAGCAGAAAACGCAATGACTAATCACGTACCTACCGTTTTCACAGCCGGACACCAGGAAGAGGACATCAAGCTCAGAAACCCAACCTTGCAGATTCGTG
GCTGTTCCTCATTGTGCTCACTTCGAGCATGCCCTTCATTCGTGAATCGTAGAGCCGACTTCTGACGGTATCCAAACAAACGCAAAGTACGCTTCAATTG
ATGTATAAACCTCAGACAACGTGCGAGTTCGTATCTCTTGGCAATGATCTCCGCCGTCTCGTCGCCCGTTAGGACAAACCCACTCTCGGCTAGCAAATAC
TGCGCAGCTTTAGCCGTCACTGAACCCGTCGGATCATCCGCATACGCGTCAAAAAGCTGTTTCATCGTCTCCACTCGCTCGAGCTCTTCCCACTCCAACG
AAATCCCCAACGACGCCAAATCTCGTGTCAACGGCTGTTCGTCCTCAATCTGCTCTCGGTACATGACAAACCCTTGGAACGTAAGCCTCCCTTCCTCGTC
CAGCTCGCACATATCACTCATATACATTCCCCAGACCTCTGAGCTCTCTTCAAACGCCCTCAACTCCACTGAATCGCTCGAGCACTGCAACGCCGCCATG
TACTCCAGGAACTCTTCATGTGTCCACCTTTCGTCCTCGTCTGCGTCAAAAAGGGTCCAAATCTTCCGACACTTGGCTTCTCCCAGCGGCGACAGTCTCC
ACTCAAGTCGAACTGCATCTGGAGCGTCGAAACCAAATCGAAACGCTGCAGAACTCGTCAAACTCGCCACAGTCCGTCGGAACAAGGAAGTGGTCGGGTT
CCAATGGGTAGCGGGCGACTCCAATAGGTACGCGCTATTGTATCCATGCGTGACAGCTCCAGCCTCCCTCAGAGAGTTCTCCACCGCCCTTAAACTGGAT
CGGATCTCGTCTCTGCGCTCCAGAATCGCCGCCTCATTCGCGGCCAGCGCCTCTTCCTCCATATTGATACAAAATGTAGCCATCTGTAGTTGAAGCGGTG
CGATCTTTCATTTTATTGGTAGAAAAGATGGATTTCCAACCAATTAAAAGGATTTCATTTGGTGGAACAAGGGGAGAATTTGATTCACTTGGGACCTGAT
GGACGAGGCGAGTAAGGCGACGCTGTTCAACGCGCTGGCGTGGGTGGACACGCTCAAGACGCGTGAAGGCGTGGATGCACAGGAGATCGACACGGCGCTC
TCCCGTCTCACGTAATTTCAGCATTTTGCTTGGTCCTACAAGCTGCAAAATCTCGATATGACGTGTTTTTCTAACGTAACAGTTTACTTTTTTATTATTA
TTTACCACATAGTGAGGCTTTCGGCGTGGACGTGCACGACGCCGAGCAGCGACGACAGCTGGCGGTCGATGGCGACGCCTCATTCGACGAGATTTTTGCT
GCGGGGCTCAAGGCGCTGAACCTGGAGACTGGCGCGAAGGAGGCTGTGGACGAAGATCCTGTCGTTAAAAAGCGTACGTGGATGATTTTTATAAGAGAAG
GAGGAGAGCGCTGATTGGCTGCTTCTTTTCTTATTTGTCAGACCCGGAGCTCTGGAAGAAGTGGGTGGCCAAGCTGGAAGCCAAGGGTTTCTTCAAGGAC
GCGGCCCCTGGCACCAGTGAACATGCTACCCGTACGGCCAAAGCGCTGGGTAAATTTAAGGAGAAATTCGGAGATGTGAAGCCGGAGCTTTCCCAGGAGG
AGAAGGAGGCCAAGGCGGAGGAGGTGAAGGCCCAGGGCAATGCGGCTCTGAGTCGCCAGGACTACGAAGGAGCTGCCAAGTTGTATCGAGAGGCGCTGCA
GCTGTCACCAGAGGGACCGTCGTCGCACATTTACCACTCGAACTTGGCTGCGGCGTTGATGTACCTGGGCAAGTACACGGACGTGATCGACCACTGCGAG
CAGTCGATTGTGCTCAAGCCGGCGTACGTCAAGGCCTACTCCCGGTTGGGCAGCGCGCAGCTGCAGCTGCAGGACTTTGACGGCGCTATCGACTCGTTCC
GTCGTGGACTTGAGGTGGACAGCTCCAACGCTGCTTGCCGTGACGGCCTTGCAGATGCTGAGCGCAAGCGCCGCCAAGTGCAGACGACGAGTTCTTCTTC
GGCTACACCCCCTGCTGGTGGCGCTGGTGGCATGCCGGACCTGTCGAACCTGGCCAGCATGCTGGGCGGAGGTGGCGGTGGCCTCGGCGGCGACCTCATG
AACAACCCGCAGATGATGCAGATGGCCCAAAGCATGATGCAGAACCCGCAGATGATGCAGATGGCGCAGAATATGATGCAGAACCCCGACATGCTCAGCG
GCCTCATGGGCGGCCTTGGCGGCGGTGGTGCTGGCGGTGCAGCTCCCTCTGGCCCTGGTGCTGGTGGCATGCCCGACATGAGCGGCCTCATGAACAGCCC
TGAGCTCGTGGCGGCGCGATCCGACCCGGACCTGGCAGATTTCTTCCGCGACGTGGACGCCGAAGGCCCGTCGGCCGCTATGCGCCACATGTCGAACCCC
AAGGTCTCGCAGCTCATGCAGAGCGTGATGGCTGGGATGCAAGGTTAGACAGGACAGCAAGCAATAGCGACGCAGCCGTTCTACTGCTTGCAGACGATAC
GAGGACTGTAAATGGCAAGTGGTGAGTGAGGCTCTAACTGTTTATTGTGTGCGGTGTGGTCGTCACGAACCTCAAGCAGCCTGTACGGTATGCAGCAATA
CGGGTTTAGTGCTTGACGAAGCTCTCGGCGTCCTGGAGGAAGGTCAGGTACTCGCGCTGCTCCTTGAGATCAGCAAACTGCGCGATGAACTGCGCCAGCT
CGTCGTCGATCTTGCGCTCGGCCAGGTAGCCGTAGAACTTGTCCTGCACGTCGAGCTCCAGGTCAATGAAGTTGGGCCCAAAGTACAGCGTCTCGTCCTC
CGCGTCCTTGGCAAAGTCGCTCAGGTAGCGCACGCGCTCCACCGTGAGGTTGCTGCTGGCCACGCAGTCGAACTGCAGGCCCTTGTTGTCACGGGTCACG
TCGGCCGTGAAGCGGACGCCCGGGAGCTCGTCCTCCTCCTCTTCGTCTCGTCCTGCTCCTGCTCGTCGTCCTGCTCATCGTCCTCATCCTCGTCGTAGTC
CTCGTCGTCTTCGAGCTCCACAGTGTCCTGGGCATTAAACTTGATCCTGATGGACTCGGAATCCACCGAGCCCTCGAGCAGGACGTCCATGCAGCCAGGA
GTCTCCTTGAGGGCGAACACCTCCTCCACCTTGAGACGCAGAGCCTCCAGATCGGGCTCCTCGAAGCAGTTGGCCTTCTCCTCGGTCACTTCGCGCTGCA
ATAGGAAAGAAGTAGGTAGTTTTAGGTTAGAACGCGGTTTTTACTGGATTGCGAGCGGAATTTTACGAGTTGCATGACGTACGTTGAGAATGGACACGAG
CGTCGACTTCTCGCGGGTCTGCAGGGCACGCAGCGCCACAGAGGGCGTGCGGCGTACGGCGGCGAATGAAGCAGCGCGAGCAACTCGGGCGAACATGATC
TCGTCCTGGAAGATTTGAGAGTGCGGTGGAGCAGCTTGGCCACATACTAGATGGCGTGTGATTGGCGGAAAAGAATGGGTTTCAGCGAATGAGGAGAGCG
AAGGGCACGCTGCGGTGCCCCATTTTCAAGAAGAACTCACACTTTGGCTTTTTCTTCGTTGCGGTTGGACTTTTTCTTCGTTGCGGTTGGACATTTTCTT
CGTTGCGTGTGTGCATTTTGGTGGCGAGGATGAGAAAACGATTGACTCTCGAGTTCCGCGACAACCCCCCCGGGTTTTAGATGCATTTGGGATCTTATTA
GGCTGCGAGTGGACAGGAGAGCTCCACGGTCTCACTCGTGCGAAGGATTCACCAATTGACCGGGGAATAGTACGAATCTCCCATTGTAAAGGCTGAAGAG
GCTACTGCGAGAGCCCCACGCGTATGTTCTCTAGATGGTGGGAGGGACAGTTTCCAGCAATTGGAAAAACAAACTTTAAGAAGGAGGAACTAGGAGAGAA
ACAAAAAAGGCGAAGCTGAGCCACCAATTCACAATTCATGTTGAGACTTGGTAGAGGTAGATACTGTCAAAGTCTTGAGCGTCGTCTTCATGGACGAGTT
GACTTTTGTCGACCGATTTAGCAGACAACCCCCAACGAGAAAGTAGCGGCGCGATTGATCGGTTGATACTTCGCAGTTGGTACGACAAGTAGAACTGGCA
GGACGTGCAGTTGCTGCAGCGGAAGATGAGAGCGACGGTGGCCAGCACCTTCTCGAAATCTGCAAGTTGAGGGAGTTAGATGTGGTTTTACAGTTGATTC
TGTTGCGATTGTACCTTCAGACTGGTAGAAGCAGTCGGCGGCGAGGATGACTTGGACGCTTCGGAAGATGGCGAGCACTTTGTCCGGTACGAGCATGTCG
CCCCAGGTGAGTCCAATGAACTGGGCACGATCCTCGAGACCGTTTAGCTTGATGTTGACTTCTGCGTTGCGCTGGACGTCGACAGCGTCGGGTCGATCGG
TAAGATACACCTTCGTCGCGCCACACAACCCAGCGAGGATCGACGGGAGGCCAGTGCCGCAGCCCAATTCCAGCACAACTTTGTCGCGACACAGCGAGTC
GACTTCGCGGGCGACAAATCGCGACAGCAAAAGTGCGGACGGCCACACAAACAGCCCGTAGTGCTTGTCATTGTCTTCGTTGGCCTCGTCGAGGTCACGG
ATAAGCTCGACAAGCCGCACGTCGACGATGGAAGTCTCACCAAGGCGTCGCCGCTTCAACTTCGGCTCTACAGCCGTCACCGCACCTTGAACTTTATCCA
ACGGCACTGCTAACGCCGCGTCATCACCACACGACCCACAGACGAAGCTGAGCGTGCGTTGCGACGCAGCATCAGCGCTCAAGGCCTCCATGCTGCTGCA
CCAGTCACGAAAACGGGACGGAAGCGATGAGCTACCCGTAAACTACTGTCGACGAACAGATCCACTTCAACTTGGGAAAAGGATCTTGAAGCGGATTCAC
CAATGCCGGCAACGCGACGGTTGGAACTGACGGCTTTCGACCCGCAGGAGCAGTATTGACACCAAACTCGAAGGAAAACGGACTTGGACATGCAGCAAGA
CGAGGTTGACCAAGCTCTCGACGCCACCATCTTGCTGCCTGATGAAGAAGCCTCGCTGTCGAAGCAGATCATCACGAACTACTTCACTAGCGACGGACCA
CGAGCAAGGAGGCTGGGTTCCAGCGACCTCGAGCCGGAGAGAAGCATTTTGGATGAAAGCAGCGGAGACGAAGAACTTCGACATTCTGGGAAGATGCCAG
CCGAAGTACTACATGAAACGGAGAGAGAGCCATCGGAAGTATACGAAAGGGAGACCGTGAACTCTGGAGTTGACAATCGCGAGGAAAGAACGATGGGGAT
GCTCGAAGAAATACTGACCTGGGAAATCGCGCTGTCAGTGGTAGTCGTGATTTTAGCCCTGGCGCACTGCGTGTGGATGTGGAACTTGGTGGAGCTCAGC
ACTTTGAATTTGGAGTTTGGAGACTAGAAAGTGTGCGCAACGAATACAGTTGGAGATTTCAGCATGCTATGATGAATATGCTACTGATCTGTCTGTTGAA
TGTGTGCACTACCTTGCGCTGTGGAGGACTATAGCTGCAGACAAGCTTCGATCTGTTGCTGCATCCGTGTTACGTGTTGACAAGAGAGGTCTCCAGTACC
TTCTAGGCCTGGGGTGGCACACGCTGCCTCGTGGAGCAAGGTTAGCTGACTTGCATCGAGCGTTCTCAGCACCTCTTGAAACAGGGCGTCTTGATTAGCC
ACTCCGTTGGGCTCTTGCATCTCGCCGACTGGCGACGGTTGCTGAATTTCCTCCTCCTCGTCCCAGTTGTCCCAGGATTCAAGTGCTGAATTTTGCTTTC
CATTAACACCAGATACGGTGAGGGCCTGCTGTCGCTGGCTGTAAAGACTGGCAATTGCAACCAGTAGCTTCTCCTTGCTGCGGTTGCCGCTAGTAGTGCA
TGACAGCCACATTTGCAGATAAATATCCAGCAAGTTGGCGTACGTTGCGTCTTTGATTTTGGTCTGCGGAGCACCAAAGGTGTCACTGAGGCACTGAACA
ATTTGTCGAACTCTTCATATAGTTGGTGAGAGTTCGGGGAATGAAGTAGCATGCTAAGACTTTCTAAAGGCTGGATTGAGCCTCTGACTTGTTCATCGTG
ATCCAGCGAAACATGTCGTGCACAATAGCCACGATAGAATGATGCGCTCCAAACACAGCCATCGAGAATACCACGACAGGCCAAAGTCACGTGGTTGGAC
ATCATCTTTTGCGGTTGAATCCACAGTTTCAGCCACGTAGTGCATCGTCGAGACAACGACCGGAAGCATAGGCACCAAGAAAATGCTGAACTGACGATCC
AGTGAGCTATTGGCGCTCACGGTATTTCCCATTTGCGTTCCTAGCTGCAGACTTTGGGGGAGATTTGCGTGCATCGCTCGTAGCGCGCCATCTAAAAGCT
GAGTTAGCTGACGAGGTGGATCTGCTGTTCCTCCGAAACAAAGGAACGCTAAAAGCCTAATCTCTACTTGCCCCACTGCTGTTTCTGTATCAAGCGGAAA
GCTCTCCGGATTCATTTCCATTGCTGCGATGCCGTCCCACACAATTGTCCAATCCTCTACTAGTTTCTGCGAAAGAGAACTCGAAGCACAGCTACCTAAG
GCATCCACACTTTCTTGCAAGTACCGTAAGTGCAGCAAAGTGAACTTCGCACACGCACAGCACCACGTGTGTCCGCAGAACCGCTCTGAAACTCAGTAGA
TGAGAGAAATTCCAGCTGATCGGTCCAACAACTAGCCTCATTAACCCAGGAAGAAGCTGCCGAGAGATTCTGCGAAGCTCAAACTGTGAGGACTCGAATG
CCTCTTTCGTGTGAGCGATGCATCCACTCAGAATCTGCTGCCAAAATTCTTGGCTTGAAGCAGGTAGGTCGTTTTGGCCACGATGCGTGTCCACCCAATC
GCTAATAACCTGGACAATTGACAGGTTCTCTGGTTCCTCCTCTACTTCATTGTCATTTAGCACCCATGTCGCCCGCTGAGCTTGATCGTGTGCCCACTGA
ACTGCTTGCAAGTGGGAAAGAGACGTTGATCGTCCTTGTCGAAGATTGGTAGGCACCGGTTTCCACCTCAACAACTCATTGGATTGACAAGTCACAAGAC
TTTCGCCAAGCACGTTCATAAGGACTTCAATGCTCAAAAGACGACCTTCTCGTTGTTGCCAACAGAATCAATTGCATCTCTCCGTTTGTTAGACAGAGAA
AGTAACATCTGCTCAATCAGCTTCAAGGAGGCCTCGTCAAAGGCCGAATTTGCGCTTGGCTCCAATTCGTCATCCACAGACTTTCCTTGCTGGATACCGC
TCAAACCAAGCTTTGCCAGCGCCAACACGACACTGCTGCTCTTTTGACGAACACTGGATGCGATGTGCATGACGTATTTCTCCAGCGTTGGAAATACGAA
CTTCCAGTGCCTTAACAAGAAGCGTGAGGGGAGACATGGAGCCATCCGAGCTAGGACATCCAGTAAGCCTTCCGCCTCAAACGCATCCAGAAGTTCTGAC
TCGCTGGTGTTCGCGATACCGTCACTCTCATCGACCTTGTCATTGCGGTTCATGCGGTTTAACTTGCTGATCACTTCCTGGAAAATGAGTAGCCGTGTTG
GGGTTTCACAAAGTGCGGCATATTCCACCAAACATCGGGCCGCAAGCTGCCGAACAGTAAGCTGGTCGTGACGAAGACACTGATAAATGGCTGGCTTCAG
CGTTTGTACTAGACATCGCGGCAGTTGAGTGAACGTGTGGCGCTCATTCGCCCAAGTCGATATCTCACTGCTGGCGATTGACGGACGCCCAATATGCCCT
TGATATCCTCTTTAACCTGAGAGGTCTTGGGGTTTTCGGGTTGTGGAGATGTGGAGTCCATTTTAATGGAGCGCAGAAGATCTGACAGCGCCAACAAAGC
TCCTTCTCGCTCCGTCCACGCTGTCACTTGGGTTTTGTCGGCGCTCACACTTCGGGAGCCGACAGCGACACCGAGCAAACTGTCCATAAACTGCTCGATG
TGATTTAGGGATGGAAACTCAAACGCGATGGCTGCTGCATTCTTCGCGCAGTCCTTCCGGATTGCAGACCACAAGTCGGTCACACCAAGTAACAGCAGCC
GAACTGCTTCATCAAAGAACTTGACATCAAATGGTGGCGATGACCCCGCACGTGCAGCCTTACTCTGCGATGCTTGCCGGAGTATTTGGAAGGCGAACGT
CAGAAAGCGTTGGCGAGCCCGAGGATCCTGAATTCGCTTCACGACTTTATTCAGACTGGAGATAGCAGCAGCATCCCACTCGTTGTCAAGCAGCAGTCTA
TGGTACACATCGCAGGTTAGACTAGACGAGGCAACAGTTATGAGACCAATACATCACAACACACCCATGCAGCACATCGACAAAGCTCTGAAACTCGGCA
ACGTCGCGTCCCTCCCAGTCGACAGAGATTTGCTGTCGATCCCTAGAATCACTTTACCTCCTGCAGAATCGGTCGTAGCTCGAAACTTTCGGACCACCAA
GTAAAGTAGCAGATCTTCTAGCAATGACTGCGAGTTGTTACGGCATTCGTCGTCGCTATCAAATTGCAAAACAGGAGACTCGCAGCTCAAAGGGTGACGT
CTATCTGCAGTTTTTCACTTGAATCCGAGGCTGCAGCAATCGACGAAAAGGCTCCGAGCTCCTCGTCGTGGCCTTCAGCTAACAGCAACGCCGCACCGAC
GCCATGCAGCTTGCTCCGCTCTTACAGACTGCGACTCCTGGAGGTGAGGGCGGTTTTGCACACGCATGAAACTTGCACATGCATTAATATACATGGGTTT
GGATAAAACCATCACCTGCAAGTAGGCAACCGACGACGAATGACGCGATGGCCGTTCAGAAGCGTCTCGTGATGCTGCGAGCGCACCGAGACTGGAAAGA
GGTTTGAAAGCGGGAGTAAAGGAATTCAAAGGAGCACAACTTCAACCGTCCAAAGTCGGGTTAGGCCCAGGTAGGATTGGCAGGGGGCCAAACTACGACC
GGACATTGTTCACGCACCCCATTTCGTCGTACGTACCGCGCAACGGTCGCAATCACGGACTGTGCCTATGCTGTGCCACAGCCTGTGCGTGAGCATGAGA
GCAGATCAAGGTGATAGATATCCTGTTCCGCTCGTGATCAGTGTCGCCAAGTCATAAACTGCGGTATGTCGCCAGCTATTCGTGCACATTCGGAAATTCT
AGCGGAGAGCATCAAGTGTTTGGAGATAAGTGCTATCGTACATGACAACGCTAGTGATGAGTTGAGCGCATGTAGTCAACTTGCTAGCCAATTATCTGTT
ATGGTTGTCAGCCTCCTTCCTACAAGAGACTGAGATTTCGAGATAGGCGCTTCCCGGTTGTACACCGTAGCGCGATGTATTTGTTAGTAACAAGTCATGT
TCATGTACGTTGTACACACGTTGTTACCGCAGTCACGAACGCACACAAAAACCTACGCATACATGTATCGACCGTGCTAGGCAATACACTCACTGTATTG
CCCAGCACGGTGTACTTTGCACCTCACACAATCGAATTTGCCGCCACCAACGCCGTTCTATTATACATGATGCGTGATTTCTTGGTCTGCTTCACACTCG
TAGCCTCCCTCGTTTTCTCCGCGCAATCGCAGACGACTGTCATGGTGACTTCAGAATCCCAGTCCAACGCTCGCCCGGTGCTGTTGCTTACGGGAGATTC
GCTCACAGAACACGGCACGTACCCCTCGATGCTTGGCTGGGTCACGCAGTTGCAGGCCCGATACACGCGCTCGGCCGATGTTATCACCCGTGGACTCTCC
GGCTACAACACGAAATGGTTCCTGAAGTACGTGATGCCCGTCCTCGAGCAAGAGATCAGTACCAGGAGCTACACCGTTCCGTCTCTCATTACGGTTTGGC
TTGGCACCAACGATGCTGCGCTGGTAAACGGCAGCAACTCGGAGATGCACGTCCGTATCGAGGACTACAAGGAAAACTTGATCCAGATCGTCAACGGATT
CCAGAAGACAGCACCGAATGCGAAGCTATTGCTGATCACCCCACCACACATCGACGACGGTGCCAGAGCCAAGTACGCAGCCGAGCGAACTGATTCCAAG
CGCGGTCTCGTGGATCGCTCGAACGCCATGGCGGGAAATTACTCTCGCGCTTGTGTGGAAGCCGCCGAGGCTCTCAAAGTTCCTTTGCTGGACTTGAACG
CACATTTCAATGCCATGCCCGTGGCGACTCGAAACGCGATGCTGGAAGATGGGATCCACTTCAACGCGGAGGGCAACCAAGTGGTCGACCAGCAGTTGCA
GAGCAAGCTCCAAAGCGAGTTTCCCGAATTGATGACCTCGTTAGATACTTGGCAGGTCCCAGCGGCGAGCAAGTACGTGTCAGAGGACCCGTGGAAGCCT
GAATAGGGGATATTGGACGAAGACTGATACTGCCTCACAGATTGACCTAGTGACGGTATCCGCCGTTGATGACTGCGCAAGTAGCGTCCTAATCACCTCA
AATGCTTCACCTGGCGTGGTTAAGGTCGTAGTCGCTATGATGGCACGGTTGTCGCTCTTGCTAGAGACCCATAAAAATTCCCAATGGTTTGTCAAGTTCG
TGAGAAGTGCCATCACTGGTTCCTCGACGATGAAATCCAATGTAATCAATTCCGACAAAGCCTGGAACTCGGACGCTGATTTCACCTCCCTTTTCACATT
CTCACTCCAGGCAAATGATGCAAATAATGCGGAAACTTCTGGGCTATAGCACTCAGCACGATCATATCCGTGCGACCAACAAGATCAATATCGCGACCAG
GACTTCAACGGAGAGGATATTTGCGCTTTCTTCCACACCAAGCACGCAAAGTTTGTTGTTCCTCAAAACATCGCCAATGTTGGCTTCCACGTACTCACGA
TAACGTCCACTTTGCTGCTCCTCGGTACGGCCCCCTATCCACTCAAACTCCTCAGCTGGAGTCGGACTTCCACCGGTGAATGGAACTGTGTCCACAGGCG
CAACCCGAATTTTCAACTCTTTCATAGGGTTGTTTCCCTTGGTTGAACTCACTTCCGAGTGGACATATCGCGTACGCTTGGACAGCACAGAGTGTTCATA
CAGTTTGTCGACCTTATCGACTAGACGATCCATCCTGGAAGTCTCGCTCGCTGAACCACCAGCCCACCGCCAGCACGTGAATTTGCCTTGGCTTTGGAGC
GGTCATGTTGTTGGCTATCAAGACATCCTGAACTGCCCACGTAGCCTTCAGCTGCTCTTCAGTGGTCACCTTTCGAACATCATCAATCCCCCCCTATCCA
GTTGGAGAGGAACAGAATCATCGCCTGGCAGCCACGCGCCACCCTCCGTCTTCGCCAGGAAGAGCTGTAGGTTACGGGCAGGACCCTTGATGTCTTCGTT
CTCCGCCTTGATTGTGTCCTTCAAGTCATCCACCGAGTCGCTTTCATCTACTCGCACCGAGAAGGCGCTTCCAGCGACACCGACGACGGCACAGAAGAGA
GTGACCATCTTTCCTTGAGTCGCGTCAGTGGAGGAGGAGGAGACCTGATTTTCTCGAAACGCCAACGCCGAGGCCAAGGTCGTGCACTACCTTGGATTGG
TCGCCAGACCAGGGGGTTCGCTGGACATCTGCAACATGTCCATAACGAACGATCACATTGGGGAGGCCATTCTGAAGACGCTTGCAGAAGGCTGCATCAC
TCGCATGATCGTCGACGAGCAAAGCGCACTGCAAAACAAGAAAAACATGTCGTGGCTACGCAGATTCAAGGACGCGGGGATCCCGATCAAGACTGGGCGC
GTGGCCAGCTTCATGGTCCACAACAAATGGACGATCGTCAACGGTGAGTTTATTTTACAAGGCACGGGCAACTACAGCACGGCCGCGTTCGATGGAGTCC
GCCACGCAGAGACATTTGAGACGCGCACGGCTCAGGCGCACCTTGATTTGATCATGCGTGAGTTCGAGCTGCTCTGGGAAGAAGGACGGGTGCCCAGAAA
TTCTCCATCCCAGAATCCCAGAACAGACGTTTCGTGCAGGGCACGTGTCCTAAATTACGGGTGCTGGTAGGAGAGCCGGCTGACAGGGCTGCTCCCCTGG
TCCCCTGGTGCCACAACGCCACACCTGGGCTGCAAACTCTCTCCTCGTTCGTGCATGCTGTAATAATGCGCGACCGTCCGTCGATTCCAGCCCGGGTGCT
CCTCGCCTTGAAGCATCGGAATCTAGTGGTACAGTCTCAAGATTTGAACGCTGAAAACAAGAGTAAGACTTCACAAAAAGCAGCTTCGGTATGTTACAAG
ATGAATTGGTGTCTGCTCTCGTTCGTGTCTACTTCATGCCACTATCAACTTCTAATACATTTCGCTACATTTCGCAGCGTGCTTCACACTTTACAACTTG
GTCACACCTGACCGTTGGCGGACGTGCTCGGAATAATGAGCATGGAGTGGCGAGACGTTCGAGACAGGCTGATCCTCCGGTGCGAACTGTCGTACGGCGT
GCTCAATACAATCTCCTCGCCCTGCTCCGGGTCATCGTGCATCACACACAAAATTGATCCGTTGTCGCGACTGGAAAATGGATCGAACCCAGCAGCAGAG
GTACCGAACATGGCTACGCGTGAAGGCGGAGGAGGCATCGGCAGGTTCTCAGCTGCCAACGTTTCCATAAGTCGGTCGTAGTCAACCGAGTGGTGGGGGT
AGGTAAAATCCATGTACAACATTACTGTGGGAAAAATATTGTTTCCGATCGGGCATCCGTCGCATCGAATCTACATCGTCTTCTAGGTTTTTGGCGTTTC
GCAGTTGCTAATGTCGTCTTTGTGTTGCTCGGACTTCGAACAGCACATATGTAGCACTTGCTCGCTCGACTACTGGTACTGAAGTACATCTTTACTGTGG
CTCTCGGTCCTAGAGAGCTCTGATGTTTCTAAAGTTCTCACCAAAATCCACAACTCAGCAAGTTTCCCTCACGGAAAGCTACTTCATTTCAAGTAGTGCC
TACAAAGATAAAACTCTTTCTCCGTCAAACAAGTTTCCTCGTTCGATAGTCTTTTCCCCCCTCTTTTACTCGGGGTGCATTTCACGATGTAATTCTGCGG
ATTGCGGCCAATCCAAGATGAAATTCATTGCAGGAAGCCGTGCTGAATGGGCTACATAGGTGGTGTTTACACTAGATCCACTCAAATAAAGAAATCCCTC
GACCACATCGGCTAAACTATCGGGGCATCTTAGATGTTCCCTCTTGGGTTCTCTCAAACCTTGAAGCACACACCTTGTAGGCGCTCTAAAATATATCTAT
AGTATAATTACACACTCTCTCTCTCTCATCGGTCCTCGTCAGACCCATCCTCTGATGTCCACGGGTCTTGAGCCGCATAATTGCTCGCTCCAGGAAATTG
CCACAGCTCCAGCTTCGCTGCTAAGCTAGGGAACTCGTCTGCAATCTTCGTTACCACCTGCAGGTACACGAGCTGGTTGCCCGAAATGTTGAAATGCAGA
CCGTCGGACGTCAGCAGCAGCGCGTCCCGCGTCGACTCGTTCATGGCGTTGAAGTACGAGTTCAAGTCAAGCACTGGGACCCCGATACTGGCGCCCGTTT
CCACGCACGCTTGAGCGTATTTCTTGGCCATGGCGTTCGTGCGGTCGATGGTGCCGTTTTGCTCTTTGGCCATTTCGGCTCTGGCGCTGTCGTTGACATG
CGGCGGCGTGATGAGCAAAATATCCGCGGTGGGTGCCGCCCTCCAGAAGCCGCTCACGATTTTCTTCAAATTGTCCTTGTAGGCTTCAATGGGGACGTGC
GTCTCCGAGTCGTAGCCGGTTGCCAGTGCAGCGTCGTTGGCGCCGAACCAAATGGTGATGAGGGACGGAGTCGTGTACACGCGCTTCCTGATTTCGCGCT
CGATGGTCGGCGCAATGTACTTGAGGAACCATTTCGTGTTGTAGCCCGGGAGTCCTCGCGTGACGACGTCGGCAGTGCGCGAGTATTTGTCCTGCAGCAT
GGCGGCCCACCCGCTTTTCGCGACGTCGGTGCCGTGTTGGGTGAGCGAGTCACCCGTGAGCAGGACCACCGGACGGGGATCCGGTTTCGTATCTGCGAGC
GCAATGACAGCCAAGCGACGACCGCCGCCGCAGCGAGGAAGCCGAGCAGGAGGCATTTGGCGCGCAGGGTCAGCAGCATGGTGGTGTGGCTGTCGGGCAC
GAAATGTGATTGTGGGGCGACCGTCGTCTCTGCGCGTCGGAAGATCCATGATGATGCACGAAGCAGGGCAAGTGTCCGGTCAAGTCATAATCTGCGACGG
ATTTCCAGCGTATGAAGGAGAGTACGGAGTGAAATGGATAAGCGGATTCTCAATGATCCGTTAGTGTGCTTGGCAGCCCAGCCTTGGCTCATCAGGACGT
CCGTGGTGCGGGGCAACATGAATTGTACATGTAGCGGTGAAAATGGTGCTTTGGAGGCATCCTGTGGCGTGTCGCGTACAGTGTACTGTTGGGGCGTAAA
CGTTGGATGTTTCTGGTGGTCAAATCCCTGAGGCGAGGCCTGAGTTCAGTCAAGCAACGCTAACCAATGCTCGGTTCGTCGGCCCAACAAACCGCGCATT
TGCTGCCGGCAGCTTGACTGTTTCGTTAGAGCCGCAGTAGCACTGATATATGGGCTTTCAGTGTTTTACTCCCTGAATGTCAAGGCAAGTGGTAAGGATG
AATACAATAGTAAGGATGAAGCGACACAGTCCATTCGACTGAGCGGGGGGGGGGCAGATTTGCTCTTGCTTCTGCGAAACCTTACGATCATTTTCGTCAC
CAGCAGGCCCGCACTGCAGGCAGATCTCAAACTCCTTTTCGATATGACCGTAACCTTCCTAAATGATTTGATACCAGCTCAGTATGATATAATCCAGAAT
CTAGTACAAAAAGAGCCAGATTTTGTGTGTTAAAATTATATCTCATACAGAACCGGCACTTTAGTACGGATAAAATCTTACTTTAATCGCAAAAGTCCGT
ACATTATCCTAGATATTGTTGGGATATTACGTCCTACGCATATCTAAAAAAACACAACTGAAAAGCAGCTTCACCTCTCGATCGGCACCACAATGTCACA
CCTGGGCTGCAAGCTCTCCCCCCGCTCGTACATGCTGTAGTAATGCGCGACCGTTCGTGGGCTTCCAGCCCGGGTGCTCCTCGCAGATGGCCTTGATGGC
CTTCTTGCCGGTCTGGGGGCTGGGACTTCTCTCAAGGGAAAAAATGTGAACTCTACGGTTCACATTTCTGTGGGCCGAGCTTGTCCACGAAGTTCTTGAA
CTTTTTGGCCGGGTTCTCATCGCCCAACACGTCCGGGTCGACAAGTTGCCGCAGTCCGTCCGACACGAGGTTGAACTGCGGCTTAAATTCCACGGCGTAC
GGCTCGATGATACTTTTACGTCGTCGTGGCCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCGTCCAGCTCGTCGTACGTGCGCTTGGTG
GCCTCCATGAACTTCTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGAGACTGCACCAGCTCCGTGTCCACGATGTTGATGCCGA
TCTCCGTGTCGCTCGTCATGCTGCGGCGGTTCCAGTTGGCCGAGCCCAGGGACACGTACACGTCGTCCACGATCACCAGCTTGCTGTGGATGTACAGCTC
CTTGGACTCCTTGGTCGAGTACAGCTTGAACTTGTCCGGGTACGCTTCCTGGATGGGAGATACCATGTCGTACAGGTACTTGGCGTAACCCGTGTACTCG
GCTTCAACAGTGCGCTGCATGATCACGATGAGGCGCTCAATGCTGGGCATCATGTCCATGATGGCCTCCAGCAGCTCCGGCACGAGAATGAAGTACTGGT
CCTGGATGAAGATGTAGTTCTGCGCGTTCCGGATCGCCTTGATGCGTGCGTGGAAGATGGACTGCTCGCCCTGCGGCGCGAAGCCGTAGTGTTCGTAGTC
TGGGCTGAAGGTGCGGCATAGCTGTACGGCGTGCGTTCCATCTTGGGGAATTTCCAAGGGAACGTCAGATTCATCGATAGGGGCAATTTCGAGTAGTCTG
GGTTCTCGAAGTCAAGCACGTCGTCAACTAGATCCTGTGACGGCTTGGGATCGGCATTCCACCGGTCCAAAAAGTTGGCCGCAACGTCCTTGGAGGCCGG
ACCCACAACGCGAGCATGAGCGTCCAACCAGCCGTTCCACAGACACTTGATGCCCGTCCGTTCACGCAGCTCGGCCTGTCGTGCTCGACTGTGTCCCAGC
GGTCGTTGGTCAGATCCACGCCGCCCACGTAGGCCACGAGGTCGTGGCCTCTACGGACAATCACCGACTTCTGGTGGTGCGACGATGTGGGGAACGGCAG
GCGATCATCGTACACGAAGCGCGCAGGTCCGTACTGTTCGGGTGGAGGCAGCGCGTTGATGAGGTCGCGCACCTCGTGGTTCTGCGCACGCTCCGTGAGA
TTGGACCACACGAGCATGCGCCAGTCAGCGCCGCGCTTCACGGCACCCTCCGCTAGGTCGCAGAGTTTGGTATCAGGCTCGAGCGGCTTGAACGGCACGT
TGCATGTGCCCCAGCCCGCGAGGTACACGAGGTCTCCGCGGCGCACCTCCATCATATCGTTGGCCACGTCATTGAAGTAACCAGCAGAGGCGACGTAGAG
CTTGACGCGGTTACCGGTCGAGTAGAGCTGAATGCCGTCACGCTGATGACCAGCACGGGACGTGAGCATTTCGCCTTCAGTGAGAAACCAGCGCGTGGGC
TCGAGGTAGGGCTGGTCGAAGGGCGCGGTGGCATCTTTCTCGGCTTTTGCTTGAGTGGAACGGGTCGACGATGAACTCGAAGGCGCGGCTCAATCCTTCG
GTAAGCTCAGTGAAAGGCGAGGACGACATGGTGCTGCTGTCGCGGTTGCGTTAGAGGCGGCGGAATGCGAAATGAAGGAGACTTCCGGCCACCCGGTCGG
GCTAATGAGGATTACTACCATCGCGTCGGAGTTGATCGCCAAGGCTGCCATAATAAAAGATCATCTGCGTGAAAATCAGGTTGGCTTGAAAGTGTTGATT
GCCACAGCATGCTTGTCTCTCACCGCCAAGCACAATCCCATGATCTCTCCGATTCTCACACGTCACAATATACGAACAACCATGTTGGAACTTCATGCAT
CTGCCTTCCAGGGGTCTTCTATAGCCCAGGCACTAGCTTCAGGGAGCTGCCACTCTTGCATCGCCTTGTCTAAAGCAGGAAACTGCGCTTTAATGGCATT
TCGAATCTGCTCGTCCGCGATCTTGTGGCCATCGGCGTTTAGATGCAGACCATCCTCCAGGAGTAGCGCGTTTCGTGTCGACTCAGGCATCGAGTTGAAG
TATACATTCAAATCCAGCACTGGCACATCGAGAGCCCTACCAGCTTCAAGACACGCTCGAGAATATCTTCTTGCGTTTGCATTCGAGTGGTCCACAAGGC
CTCTCCTCGAGTCGTTCCGCTCTGCGGCATACTTGATTCTGGCAGTATCGTCGACATGGATCGGGGTGATCAGCAGAATGCTCGCATCCGGGGCTGTCCG
TTGAAAGCTGCTCACGATCTGGAGTAAATTCTCCTTGTAGTCCTCGATTGGGACGTGCAGCTCTGGGTTGCTTCCGTCCCACAGCACGGCGTCGTTCGAT
CCGAGCCAAACGGTGACGAACGATGGAGACGTGTAGGCACCACAGTTGATTTCCTCTTGGATAGCAGGCATCGCGTACTTGAGGAACCATTTGCTGTTGT
AGCCCGAGAGCCCACGTGCGATGATGTCAGCTGAGCGTCTGTATCGAAATTGCAGCAGCGTAACCCATCCACCTTTCCCCGGGTCGGTGGCTTTCTCAGT
GAGCGAGTCGCCTGTCAGCAGCAGCACTGGGCGAGGCTTGGACGGTAATTGAGAGGCTTCCGACCTCACGGTGTGTAAGAAGATTATGAAGAGAGCGAAG
AAGCAATGGAGTGCACAGACAGAGAATGCCATTGGGTTGCTGACAAAGTCGATAAATGATCGGATACTCGACAGCTCGGTGGAGGACGACGCTTTGACCG
GGTTCCATGGGTCGCGCGAGGGCGCTTGGTATCTTGGATCTTGTCGAAGCAGATTGCTTGTTGGCATGGGTCTCTCTCTTCCGGACACGGTCAGAGTTGC
ACATATGCAAGTCGCAGCGTACTGCAAACCAAAGCGTTTGCAAGAGTTCGCTGTGGAGTTGTTTCGCTCCAGACACGATTTCGTATTGGCGCGTATAGGT
ATTGCGTGATGCTGGAGCGATTTTTGCAATGCTGTTGTTTGCAGATCCTCAGAAAGGATACAACATCGCTAGTGCTCAGCATCGAAAGCAGCGACATAAA
CCGACATCCGTATTCACGTGACGAAGTTGCTGCACCGCCCTAACGAAAGAGCTGGTACGCTTCACCGTGCACGTATATGCTTGGTGTCCGTGTACCTGCG
CGGCTGGTATGGGCGAATACAGTCAGCGCGGGCTTGTTGAAATTAACAAATGCCCGATCCGCCAGCAAACGCTGATGTGGTGACTCTCACAATGACCAAA
CCAGGATCTGTGCCGTTGGTCCGGCTCGGCTCCCACTTTTCGTTGGTTTCGACGCTTACTCTGGTATTTGCTCTGCATCGCTCAGGGTCTGAGTGTTAAC
CGTAAAAGAAGCATGCGTCTGCGACTCCAAGTATTGGCGGCCATCGCCACTCTGTTCGTGAGTGCCCACGCCGCGAGCGACTCGGTTGCGGAGAAAACCT
TCACAGTGGTTTCCCCCGACTCTAATGACACGCTAGAAGGCTTGTACGTCCAATCTGAAGGCCGCAAGTTCCTCATTCTCTACGACGACTCGAACAAGAC
CGGGAGCGAAGAATCAGCGGAGCATTCAATCGTTGACGACGGCTCTTCGTACGAGGGTGAGACTTCGTCTGATGGCTCTGCCGACCAAGAAGAACGGGCG
GGGGCAATTCGTGTAGGCACCGTCACGAAGAAGGTGAAGAAAGTGTTCCCGAAAAGTACAACACTCTCTGGAACAAGGCCCTGTACTACTTGTTCCAAAA
GCTCACTCCGAAGAACCGCAGGATTCCACCTTCGTAACCCTCACGTGAACCGGAAGGTAGACTAGACCTGTAAGCGAAGCTAATTCACGTATTGAATGCT
TGGATCTTTCTCTAGTCCTTACAACAAATCACGGGGGTGACTCAACTTTTGTTTCACGAAACATGGAGACGAATGACAACTGCATATAACACGCCGCCGA
AGGATGATTGTTGGTCCAGGGACGACGCCTAGGTGGTCTTCTCTGGCTAGGTTACGCAGGTTAGGCTTCGATACGCCCACTGCGCAGGGAACAGTAAGGG
TATCACAGCTAACGAGGTACTATTTGGCATCACCCCTCAACCGGCTCCGAGCTGTCGAAGACAGCCACGAAAACCTGGCATCGAGCCAACTGCGTAGGCC
ACAACCACATGCTCGTCGGGGACTTGTGACTCAAATGGTCCGACGAGCATGTGTCCGTCGTGTACAATCACCGAACACGAACAACGAACTAGTGGGGGAG
TGCTGGCATCGTCGCCTTACTCCGAAGAATCATAGATCAACGCCTCTGCGTACGCAAAGCTAACCTCGCTTACAAGCCTGAAGAGACTGGTGCTATTGAG
TAGTATGATATCTCAGCCTGTAAGTTGTGCAACCGGTGGATCAATCGCCTGCCTGCGTAGTGTGGCTGGAGGATAGGAATCAAACCCAGCGACTGCTGAG
GCGTCAAATCAACACAAGTACGCAGATTGACAAGGCTGCACAAGGAAACACTGGCCTTGAATCGGTCATCGACGCCCTTCTGGTTCGGCGACGGTGATTT
ACGCGCATAGACCGGTGGAGCTCCGTGCCAAGAGCGTGCTTGCCCGCGTCCAGGTCGGTATAGCGTGCGGAAATCCAGCAGCGTATGATATCCCAACTCG
ATGACGGCCGCTTGGCGATTGCCCGCGGAATAGCCCCCCGCCATCCGCCAGCGAGTCGTCTCAAAACAATATGGTGGTCATTTCTGCCGCCGCCTCATAA
CTGAACCCACATCTCGTCGCCTGCTCCCATTGGCCCATATCCAACATGATTTCCACACGCAAGAGATCTCCCTTCATTCCTGCTTCTGCCGTCTCGAGCT
CAAGTGTCCTGCTTCTCCTCCTCACTCAGCCATGGACGGACTCAGCCGCGCGTTCCACTTCATCGTGGACCCGTTCCAGAAGGAGCACAAGCCCGAGAAG
GCGGCCACCGCGCCCTTCGACCAGCCCTTCCTCGAGCCCTCGCGCTGGTTCCTGACCCGGGAGGAGCTGAGCACGTCGCGCGACGGCTACGAGCGCAGCG
GCATGCACGTGTACTCCAAGGGCAACCGCGTCAAGCTGTACGCCGCGTCCGCCGGCTACTTCAATGACGTGGCCGACGACATGCTGGACGTGCGCCGCGG
CGACCTCGTGTACCTCACGGGCTGGGGCACATGCAACGTGCCGTTCAAGCCCACGAGCCCGACACGAAGCTCTGCGACCTGGCGGAGGCCGCCGTGAAGC
GCGGCGCCGACTGGCGCATGCTCGTGTGGTCCAACGTCACGAGCGTGCGCAGAACCACGAGGTGCGCGACCTCATCAACGCGCTGCCGCCGCCGGAACAG
TACGGACCTGCGCGCTTCGTGTACGACGACCGCCTGCCGCACGCCACGTCGTCGCACCACCAGAAGTCGGTGATCGTGCGCAAGGGCCGCGACCTCGTGG
CCTACGTGGGCGGCGTGGATCTGACCAACGACCGCTGGGACACGCTCGAGCACGACCAGGCCGAGCTGCGTGAACGCACAGGCATCAAGTGTCTGTGGAA
CGGCTGGCTGGACGCCCACGCAAGGATCGAGGGCCCTGCTACCAAGGACGTGGCCTGCAACTTCCTGGACCGATGGAACTCGGACGACAAGCCGTCGCAG
GACCTCATGGACGACCTGCTTGACTTTGAGAACCCAGACTACTCGAAACTCCCGCAGATCGACGACTGTGACACAGCCCTCGACATCCCCGAGGACGGCA
CTCACGCCGTGCAGTTGTGCCGCACCTTCAGCCCGATACGACCACTACGGCTTCGCGCCGCAGGGCGAGCAGTCCATCTTCCACGCACGCATCAAGGCGA
TCCGAACGCGCAGAACTACATCTTCATCCAGGACCAGTACTTCATTCTCGTGCCGGAGCTGCTGGAGGCCATCATGGACATGATGCCCAGCATCGAGCGC
CTCATTGTCATTGTGCAGCGCACGGTGGAGGCCGGGTACACTGGTTACGCCAAGTACCTGTACGACATGGTATCTCCCATCCAGAAGGCGTACCCGGACA
AGTTCAAGCTGTACTCGACCAAGGAGTCCAAGGAGCTGTACATCCACAGCAAGCTGGTGATCGTGGACGACGTGTACGTGTCCCTGGGCTCGGCCAACTG
GAACCGCCGCAGCATGACGAGCGACACGGAGATCGGCATCAACATCGTGGACACGGAGCTGGTGCAGTCTCCCGACAACATCACGGTGAACAAGCTGGCG
CGCAACTTCCGTATCCAGAAGTTCATGGAGGCCACCAAGCGCACGTACGACGAGCTGGACGCCATGACGTTCCTGGAGGCGTGCGACGCGCTCGAGACGG
CGGCGCACGACGATGGCTCCAGCCTTATCGAGCCGTACGCCGTGTCGGACAGCGCGGCCTTTGACTTTGTGCCGGACGCTCTGCGCCAGATCGTGGACCC
GGACGTCGAGGGCGATGACTGAGCGCGCCCCAGACTGTGACGTGGTGGATGATGTGTCTGTATAGCTTTGGCTTTTAGTGCTTCCTCTCTCTTGTGTTGA
GAGGATAGCCCAATCGTGTTCATCGGGTGCGATTGAGAGTAAAAAAGAATGAAAACACCGTTTGGATATGCACGTTGAAGGTGTTGAAGTGACGTTGTGC
GTGGAATCGTATGTGAAGACTTGTCAGGGATTTGCTTACTGCAGGACGACTACCAGAAGCGTTTGCTTTGTATCTTCCTTCTGGTGCGTCCTGGTCCGCG
TGGAGATCGGAGCGCCAGCCTTCGAGTGCTTTTCCGGGGACCAACGGCCGATGAGAGCTGCTTTGGACTCCCCACTTCGCACCCTCCCCGGCGTGGCGCT
AGCACCCACTTCTGCGCTCAGTCGCCCACAACGGCAACAAGGGCCAGTTCTTTGGCATCGGAGTTTATGGTGGAGCCGCGAAGCTGTGGCGAGGGAGGCC
GAGCCTCCGTTCGAATGAACCAGCTCCGTGCTAAGTGGTTGCTGACCATCTCGTCATGCGGCTTTCGACATCTTCGTCCGGGACGTCACGGTAATCACCA
AACTGCTGCTAAACTTCGCAGTGTAAACACCGCGCTGAGCTATAGTTGGTGTTTCTCGGTGGCTTCTTCATCTCGCCCTAGTTTTTCTGGCCATTTCGTG
TGATCTGGATCGAGGGCCTACGTGGGGTGACGTCAAAGCGGGGGATCAGAAATTCACGCGCCGAATCGCGGAGTCACCGACGATGGGTCCATTTCACCCG
GGATTTACGCTCTACTGAATTGATTTCAGCGGAGTTCAGTTTAGCTCTGGAAGCTCCGATCTTATCTATAGCGTAATACTTGGTCGCTGTCCTCCCTTAG
ACTTTACCCTTCCGGCAAGAGCTCGTCAAGGGTTCTCGAACTGTTGGTAAGACTTGACGCTAGTTGAATCCGGCCACTTCAACCAGTGAACGAGGTGGCG
GAGTCATTTCTACCGTTTCGCATTCTTGCGTCTCCGCTCAATCGCTAAGCGCTCTGCAGGACTCTTCCGGCATGAGCTCAGTGATGACTCGGTCGCCTGT
CCTTAGGGGCCTAGCACTGAACTAATTGCAGGGAAACGCGAGGGCTTTCACCGCTCGTCTTCCCGTTGAAACGCTGGGGAGGTTGGTCAATCCTCGCAGC
TTGGTTTCAAGGTCGGCTCGGTTGGAGCGCTGCTGTGGTAATTTAACTGCAGACACATTCTCTTTCGCATGCGTTACATGACGCACTGGTCTTTCGGTTC
CCGTTGCGAGCAGCACCGGCATGCATGAGGCAGGGGGTGGAAGATCACCGGCTGCTGACCTCATCCCAGCTTCCCGGGCTTGCAGCGTCGACTTTCTTCG
TTTCTTTCTCGCTCACTTTCAAGTTGGCGTCGTTTCGAGTACCCCCAAAAAATAACCTGCCCCACCTCGACACTACTGCTGGGCACCATGATTGACAGCA
CCCCCAAGGAGCTCGAAGCCGGCAACTATGACAACCAAACGTCACCGACTTTCAAAGGAGACCGCAAGTCCATCGTCGGCGCTTCGATCCCTCAGCTGCT
CCTGATCTCCATGCCTCGCATGGCTGTCCGGATGGCGTGGTCAGCTCAGTGGGCCGCACTTGGACCTTACCTTGGTACCATGATGCCCAAGTACGCCGTG
CAACTCGCCCAGATCATCGGCCCTGTTACCGGCATCCTCGTGGCCCCTGTCGTTGGTGCTTTCAGCGATCGCAGCACGAATAATGGGGTCGACGTCGACC
GTTCCTACTGTACGGTGCCGTCACCAGCGCCATTTGCTGGACTGCCATGGGCTACACCCGTCAGATCGGAGACGTGTTCGGCGACACCGGTAGCGGCAAG
AAAGGTGAAGAGACCAACCGATTCTGGACCATCTTCTTTACCATTTTCTTCTACACGTGGATGGACATCACGGTGAACGTTGTGCAGACGCCACTGAACC
TCATGATCGCCGACTTCGCCGGTGAACGGCAGACCCTTGGTGCTGCTCTTGGCCAGGGATGGTCCACGCTGGGGTCTGTCATGGTTTCCGGGTATATCTA
CCTGTTTGGAGCGGCTCACCTGTCGTTGCGCTGGTTTCTCTTTATGCTCTCGGCCGTGATGGTCTTCACCGTTTCAGTCGCGTGCTTCTTCAGCCAGGAG
AGGCCACGAGAGAAACTCGATCAAGTGACCGAGTCCGCTTGGCTGAGCGTCAAGGGTGCCTTCGAATCCATCTACCACGGCTTCAAGAGTCTACCACTCG
AGCTGCTCAAGTACTGCGTCGTGGTATTCTGTGTCATGTACGGCTTCTCCGCCTACAACGGCAACAAAGGCCAGTATTTCGGCATCGAGGTCTACGGTGG
AAGCCCGAAAGGCGCCAACATTTGTGCGCCTGATTGCTCTGATGCCCAAGACGCGTACAACCGTGGGGTTCGTGTTGCTGGGGGATACGCAGACCTATGG
TTTAGTCTAGTAGGCTACGCCTACTCGTGGGTGTTGCCGTGGCTTGTGAAGCGATTCGGCGCCAAGTGGGTGCTCTCAGTCGCGCTGATCCCTCAGTCCT
TGCTCATGGCTATGGCTTTCACCACCACAGTATCAGTCGACGTCACGATCGTTATCCTCACCACAGTCACGCTGACCACGGTATTCGCGCTCAACGTGCC
CGTGATCATTCACGTACTAGGGCACGAGGCTGAGATCGGTGTTTATGTGGGAGTGCTCAACGCAGCCAATTGTTCGGACAACTTGTCAACTTCTCCATCG
GTGCTGCAGTTGTTGGTACGCCTATGGGGTACAAGCTGCCGGTCTTCCTCGGTGGGGCTACGAGCTTCCTCGGTATGCTCTTCACTATTTTCCTGCTCAA
GATCAAAATGTTTTCCTTGTAAATTGCTGCTGCAGGTCATGGTTTGAAGACAAAACAAATACTTCACGTAGCAAACGTAAAACAATAGCCGCCTTGCATT
CTTCTGTGTGAAAATTAATGAGTACCTCGAACTACGGTAGGTAAGCTTAGAAAAGGAATGAAGAACTAAATACTACTTCCAAGTACGTCTCGAGCGCTAT
CGTGGCAGTGTGCCACCGCGGGTTTACACTAGGCAATACTGTACAAGTGCAAAAGCTCAGTTTTCAACTGTACTCTAAAGAGTACCACGTCCGTGTGAAA
GGGAAATATGTTGCTATTTTATAAGGCGTCGACTGCGACGCTCACTGCACGCTGAACAATATCTGAAAACGAAATGGACTAGATGGCGTGGAAGGGTGCT
ACCGCTTCCGTCTGGTGGTCACAGCTTACATGGAGTACATCTTCATCTTGAAGAAGAGCAGGGCCGTAATGAAGCCGAGTGCGCTCATGACACCGCCAAG
GAAGACGGGCAGCTTGTAGCCGAGAGAAGTTTCGACCAGCCCGGATCCGATAGCGAAGTTCAGCAACTGTCCGAAGCAGTTCGCCGAGTTGAGAGCTCCA
ACGTAGATCCCGATCTCCTCGTCTTCGCCGAAGACGTGGATGATCACCGGCACAATGAGCGCGAACCACACTGCCTGCGTGATGCTGGTGATCGCCACGA
CGAAGACGTTGAAAGTCACGCTGCTCGTCCAGGCCATGATCATCAGGAAACTCTGCGGGATGGTCGAGATCGTCAACACCCACTTCACGCCAAACTTGTG
CACCAGGAACGGAATCGTCCACGAGTAGATGTAGCCGACGATGTTGAACAGCAAATCAGCGCGGCCACCGGCGATGCTGACGCCGTGGTTGTAAGCGTCC
TGCTCCGGGGTGCACGGGTCACAGGTGTCGGCGTTCTCGGCCGAGCCGTTGTACACCTCAAAGCCGAAGAACTGGCCCTTGTTGCCATTGTACGCCGTGT
AGCCGTACTGGACGAAGAAGAAGCAGACGCCGTAAATGGCAAGCACACCGGGGAGCGTGCGAACGCCATGGTACACGGAAGCGAAGGCGTGGGCGATGCG
CTTCCAGGTCGACACGGCGTCGACCTTGCTGGGGTCCAGAGGAGTCTCCTTGCCGAAAATCACAGCAACACTAATGCAGATGAGCATCGTACCCGACAGC
ATCCACATGAACTCGTGGAGAGTCTTGTGAGCCGCGCCGAAGAACTCAATGTAGCCGGCGACAAGAATCGAGCCCAGAGTCGACCAGGCCTGGCCCAGAG
CAGCACCGGTGGTTTGGCGATCACCGGCAAAGTCAGCAACGAGCAGCATAGCCGGCGTTTGTACGACGTTGACGGTGATGTCCATCCAGAGGTAGAAGAA
CACGGTGAGGATCGACGTCCAAGAGCGGTCGGTCTTCTCGCCGTCTGCGCCGTCGCCGTGGTCACCAAGAGCTTCACCCATGTCGCGAGTGTAGCTCATG
GCAATCCAGCAGATAATGCTGAGGACGCCAGCAACAACCAGGAAAGGTCTGCGACGACCGAACTTCGAAGTGCTGCGGTCACTGAGAACGCCGATGCTGG
GGCCGACCAGCACACCGACGATGGGGCCGATGAACTGCGTGATCTGCACAGCAAAGTTGGGCAGCATCGTCGACAGGTACGGGCCCAGAGCAGCCCACTG
AGCCGACCACGCCATGTTGATGGCCATTCGCGGCATTGAGACCGCGAGCAGCAACCAGATTGGCGGGTGAGAGAGCGGAGTCTGCTCACCGCCGTCTTTG
CCAGGCTTGGGAGAGCCTTGAAGTTCGTAGCCTTTCTCGACGTCCGCCATCTTGGAGTGGAGCTGGAACCTTGGAGTGGTGTGGGCTCAAGAGCGCAAGT
TGTAGAATGAGAAAGACCGAGAAGACCGTGCGGTGGTGCTTTGAGTGGATAAACACACCCTTGACGTTGCTGGTTATCTCCACCAGCCCGTTCGGTAACC
ATCCGCTGCAGGCGAAAAAACAGCCATCCCGAGTCCCAGCCGCACGAGCAGCGACCCACAAAGTGCAAAGCTTCTGCTATTGTGCTTGGGTAGATGGGGA
GCGGCTGGTGACTTTGTGACTTTTACACTGCAGAAGATCACCACTCAGTTGAGCTGCTTCCCAAGACAAACGACTTGCAAGAAGCTTCAGGCGGTGTGTT
TGGTGGGGCGTTTACCAAATTCAAAGCACCAGAATGTTTCTATTAGACATGGTGACCAAGGCTCGTTTGACTGCACCTTGAACCGCGGCTTCGTTTCGTT
GACAAAGCGTCCTTGAACTTGTATTTGCTGAAAGGAACTCCCAGCTGATTTGTCTATTTGCGCCTCCTCTGCCAACAGTGCGCGGTGCTGTGCCAGCACC
GCGGTCAAAAGCTGGCACAGATTGGGTCGCTTGTGGTAAAGTTAGTATGCGTCGCACCAAGATCCTAGTGGTAATGAGGGCGTCAGTTAGTATTAATATG
GGCCGCATCAAGCTCCTAGGTTGAGAGGTTGCACAGACCGCGAGTGCATGTATGTATAATGCATGCATTTCGCATGAATGCAAGTTTTGATAACTTAGTT
GATCGATGAAGGTGTCGCCATTTACTTGCCAAACAAACGATGCTCACGTGTGTCATCTGATTCGTCCTGTTGCTGCAGATTAAAAATCGTGGTGCCACAT
TGAAGTGAGACCCTGGGCTATGCTCGTTAGTCCGCAGCTGAATTGTCGATTCCAGCGTTGTGGGCGAGCAGAAACTGGATTCACGCGTGCTCTCGCCCTC
TTGAGCAAGCAACTTCAAGCTCTGTTCCCGCCAGCTCTTTAGCTTAAGAACACCCGACAATAAGAACGGTGCAAACTGAACTACAGTTGTAATGCTGGGC
GATTATGCCATGCTCCAGTTCTTTCGCGGTGCTGGAGCTGGTCGAAAACTTCAACGGCAATACAGCCTACCGAAACCACGCATCATTGATGTGGGTAGTC
GATTAAAGCATCACCCGCAAGTTTACTCCGTCGTCTGGTTATCTACACTTACTGCCCTTCAATTCGGCTCGCATACACGTGTGCATGTATGCGCTCCTCT
GCATCAATATCATGGTTTCGATACGCATCCACTATACAGTCCACTACTACATGCTGTACATTTTCATCTTGTAGAAAATCAAAATGGTCAGGAAGCCCAG
GAAGCTGGCGATACCTCCGACGAACACCGGCAGCTTGTATCCGAGGGACGTTTGCACTAGCCCCGTGCCAATGGCAAAGTTGAGCAATTGGCCAAAGCAA
TTTGCAGAGTTTAGAGCCCCAACGAACACGCCTATCTCTTCGTCCTCCCCAAAGACGTGGATAATCACTGGTACGACGAGCGCGAACCACACGGCGTGCG
TGATGCCGGTCGTAGCAACGACAAAGACGTCGAACCCAGGACTGCTGACCCACGCCATGGCCGAGTAAAGGATTTGAGGCACCGTTGAAATGGTGAGGAC
CCACTTCACGCCAATCTTGTGCACCAGGAACGGCATGGCCCAAGCGCACACGTACCCCACGACGTTGTAAAGGAGGTCTGCTCGGCCGCCAGCAACGCTA
ACGCCGTGGTTGTAAGCATCCTGTTCAGCACTGCATGGGTCACAACTGTCTGCGTTTTCAGACTCTCCGCCGTATACCTCAAGCCCGAAGAATTGGCCCT
TGTTGCCGTTGTACGACGTGTAGCCATACTGCGTGAAGAAGAAGGCGACCCAGTACACTGCAAGGACACCAGGAAGGGTGCGGATCCCGTGATACACCGC
AGCGAATGCGTGCTTCACCCGTGAACACGACGACGCTGCTTCCACATCATTCGGAGATAGCGGTGTTTCCTTCGCGAATACCACAGCGACACTGACGCAG
ATGAACATGGTCACGGACAGCATTCCCATGAACCAGTGTAGCGTCTTGTAAGCAGCCCCGAAAAACTCAATGTAGCCTGCAATCAAAATCGCACCCAACG
TCGCCCATGCCTGACCAAGAGCTGCGCCCGTAGTCTGGCGGTCTCCTGCAAAATCAGCGACCAGAAGCATGGCCGGGGTTTGAACGATGTTCACGGTGAT
GTCCATCCAGAGGTAGAAAAATACAGTTAGGATTGACGTCCACGTGCGATCGGTCTCGTCGCCGTCAGTGCCGTCGCCGTGGTCACCCAAGGCTTCGCCC
ATTTCACGCGTGTATCCCATGGCAATCCAGCAAACGATACTGAGTACTCCAGCCACGATCAGGAACGGTCGACGTCGACCCATTTTCATGGTACTGCGGT
CACTGAAGACGCCCACACTTGGGGCCACGAAGACACCAGCGATAGGACCGATGAACTGAGTAATTTGCACAGCAAACCGCGGGAGCATCGTCGACAGGTA
GGGGCCGAGTGCCGCCCATTGCGCCGCCCAGGCCATTTGAATTGCCATCCGAGGCATGGAGATGGCCAAGAGCAGCCAAAGTGACGGGTGAGACTGACCG
CCATCTTGAACACTGCCGGGCTTGGGCGAAGTGTGGATGTCGTAGCCTTGCTCGTAGTCCTTCA