Description :
From Genome Similarity Track
Location :
Scaffold_5:117425- 140602
Transcript NameFunction/comments
g2747.t1hypothetical protein
g2748.t1hypothetical protein
g2749.t1hypothetical protein
g2750.t1hypothetical protein
g2751.t1hypothetical protein
g2752.t1ETP37329.1 hypothetical protein F442_14859 [Phytophthora parasitica P10297

Sequence
23177 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
AACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCGTAAAGTAGCCCCCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACTTTGAACTCTCGGACTGCTCGTCGACAGCGGGGATCGGTCATCGAGGATGGTTTCTACCTCATATTCGCCAGCGAGC
TGGTCCGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCGGGTGCTAACCGACTCTTCGGTCGGTCTC
CGAACTCGCTGACGGTTTTGAGTCGGGACACGTGTACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCAAACTCTTCAAT
CTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGAGGGAGTTGCTTGGTCAACCCTAGCTTGACTCGTTCCATATACAACCAAACTCTGCTCCCGGGT
TGGAACAGAGACCTCGGTCCTTCGACAGTGGGGTCAGATGTTGCCCCCGTCTCCACCTAGAAGTCTCGTTTTCATCAGCATTCGGTACTGCAGCTCTCTC
GCGCCGTTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATTTCCTGTTGCCGGTTC
ACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTGCGTCCCACCCATGAA
CTAGGTAAAACGGAGTGTCCTTTCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTCTTGCTGCAGCGGGTC
TTCTGCGTACACCCACACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTCGCTCTTGACCGAGAC
TGCATCATCTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATTAGAGTTGGTGCTCCGAATCTTCGGTACACGCATT
CCTCGAAAGCCTGTGCGACCTTCAGAGCGGTAGTGTCCGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAGTAGTAGGGCTGAGTT
GCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCCAAGACATTTCCTGGCGAATAGCCTCGGAACTGT
GGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAGTCTGATTTGACTCGGTGGT
AAGTTCGACCGATACCTTGGTGACCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCTTGAATCATCGTTGTGGGCACCACTAGACGCATCGTTGT
CTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTCGGCCATCTTCCAAGCGTCT
CTGGCTGCTCTGTAGCTTAGGTCTGTTTCCTGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCGTCCTGGGCGGCGGAGATTCGTCGCCGGCGCTCTTC
CTGTATAACCACAGGGTCAACGTCTTCTGCGTTCGGAGCGCCAGGGTCCGCCTCGTTACTCGATTGCTCGGCTCTCAGCTCGTTCTGAGCTTCGGTGGTC
ACACCATTCACTTCGTCTCGTTCAGCCGCATCATTCGGACCTATTACCGAAGTCTCATCCACAAACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTC
TGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTACTTGGGCTCGGGCGAAGCTGAC
TGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATAACCTCTCCGATCCGGTTCAGCTCGACCAATTCTAATTTCTTAGCCTCGGTCAAG
GCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCCTGCCAACGAATCTGCCGCAGCGTTGAACTCTCGGACCACGTGCAAATACTTCACTGACCGCAGTT
TGGTCGTGAGCTCTCGGTGACGATTCAGTTGTACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCC
AACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCCGAGACACCGTTGTTCATTCCAGCATACTCAGCGAGGTTTACCGTGGTAGTCTCGAGATAC
GCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCCACCGTTCGTTTCGGTCTTGGGCGAACCATCGA
ATGACATCACGAATCCGGTATAGGACCTCGGTAAGCAAGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCCTTTCGTCGGGGGTGTAACCGG
GGCTAGCGAGTCTTCCAATTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTGCAATCGTGTTCCTTGACTCGGTTGACCACCAGGTGC
CACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAAAACGCGTATAGACGTGGATGG
TCCGACCCACCAACTGGGAGTAGCACACTTTCAGCACCAGCAGTAGCGCTAAGACTTCCTTTTCGGCCGGGTGGTAGTTCATCTCGGCGTCCTTGAGGAC
TCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAATAACGTGACATGCGCCTCC
TTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTTCGTTTGGCTGCCGAGAGGCTGCCACTAGGCGTGA
AGTCTTCGTCCTTCAACTGGTACAAAGCTGCCCCATACACTGCGAAATCCTGGATGAATCGACTGTAATAATTCAGCGCACCGAGGAGAGACTGCATCCC
CTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGTGACAGGAAATCCACC
TTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGGCATTCGGTGAACCGTTGGAGCAGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAG
TCTCGGACCCAAAACAGATGTCATCGATAAACGACCGTCGGTCGAACACTGGCACCAACAAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCGGCAAC
AGGGCTGTTCACTAACCCATTCACCGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGTCGGCCGAGTTGTTGACTCCTCGGGTCGTCGC
AGTGAAGGGTCGGTCACCCCTGTCCGTGCAACCTCGGCATGGGCTTCGGCCGTTCGCATGAGCTCCGAGAAGTGGAGCCAGCCGCCTTTGGGTTGGACGA
AACCCCACAGAGCATTGTCGATCATTCGTTGGTAAATCATCGGTGCGTTCTTCAATCCAAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGAC
GAATGCCGAGACCTTGCGAGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAGCAGAACCATAAGTAGGCTTCCAGGTCGGTC
AACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTTGATGCACAACCGAATATCAACTCCATTCTTCT
TGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGGCGGGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTG
TCGGAGCGGCGTCCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCA
CTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAAT
CCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCCAAATGTTCGGACGCATT
GGTATCGGTGTTCTCACTACCTGAGCCGTCCCCCTTGGTAATCTCATGCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGG
ACTGGGATGGAATCCTCTTCACTCGTATACGTGGTATCCGCACCATCAGAGGTGTCGGTCGCCACGGAGTCGTCATCCTCGCCGACCCAACTACCTCCAA
CGGGTTCATCAGAGGATCGCATCGTAGTCATAAACGGCATTCGGTCTCGTTCTGTCGGTTCCTCAGTACTCCTATCTGCGAACGTTATCTGGCCCTCGTC
TAGGCCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCGAGGTGTCGGATAGTCTCGTCGTTCTACAGCGGGTGGCTGATCTGCCAACCATCATTCG
TAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAATGAGTGTATC
CATCTCCTTGCGGCAGGTCACCCCTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCAT
TGTCGGCTGCCCCCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGT
AACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCG
ACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCAGCTGGAATCATGAAGTCTGTTCCCAAGAC
CACATCAACTCCTGCACTGTGATCCATAATCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCC
ATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGGTCTGGAACTTCGCGCAAGCGCAACCGTTTCGCATATGACGCGGAAATCACACTGA
CATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGA
CCACCACCCCATTCTCTCGCCAGATAACAGTTTAGTCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGTCCATGCTGAGGATCGAAGCTTCGGTT
AACTCCACTTCGTCTCCGTCCGTACATCGCCAATTCACTTCACTCCCACCGAGACTTACACCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCA
TATTCAAGTCATTGGGCCGTTTGCACACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAA
CCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGA
GATTCGTGAGTTCTTGGAAGGCCACACTTCCCGGCATCATGAACTTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTC
CGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCATCTCGGTCATACGGCCGCTGGCCGTTACTTGCCCT
CGGCCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGCTCAGTGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCG
TATCCATCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAATGAGACTCCGGTCCGTACTCCTCGGTGTCACCATAACCGCCGTTGTACGCTT
CTGGGTATCCTCCACGCGTGTCTGCCGAGCGTCCCGCATTCAGCGCCGTCACTATGTTGGTCAGTGCGTCAGTGAGAGTGACCCTCGGTCGATACTGTTG
GTCATCCCGGCGACGGTTATCGTCTCGGTAACGATCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCG
GAGTGTCCACCATCGCGTCGGCGTGCTACTTCTTGCTCTCGAGGGCAACGGACCGAGGACTCGCGTCCAGATTTTCGCTCTCTGCGACGAAGGATATCAT
TGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGATGCTCTTCTAGACCTCGGTCTTCGCACGAATCCAAGAAATGCTCGACGTG
GTCCTTCGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCT
CGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTGATGAACGCATCGCTCAACAATTTCCACGTGCGCCTCGTTT
TGCGGGGTAGCTGTCGGTAACACCATCTTGGAGGCTCAATTCAAACGCCATGCACCATTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAAC
GCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGTTTCCGAGTGGGAGGTGCGTGGCGATCTCTAGCCTCGGTG
TCGCCCTGTCATTCTCCACAGCGCTCAACTCACGAATTTGGCGTGCCCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCGTC
AGACGAGTCATCGCGGAGGTCGTAACGTCGGCTGGGCGTCCAACTTGCGCTTCGTCCAGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCAGT
CGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGACGTCGCACCTTGGGCCGAAAAAATTCCGGCCTCGGTTGACC
CTCTGGGGCGTCTCCCAGGGGTCAATGGCAATGGAATCATGGACGGGTCGACCGGATCCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTC
GGCCACCCCGAAGGCCGACCAAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGATGCCCATGCTCGGAGGTCTGCTTCCGACGGGAAC
ACTTGGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTACTCCACGACTCCACGGGCACAGTTAACTCGCCACTGA
GCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTCATGAGTTCTAGGTATCGGCCCAGAACTCGGTT
GGCGGCCGGGGTGTCTCCGTTAAGAGGAGGCCGGCTGCCATTCGGCCGAGAATTCGCGTCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCT
TCGTCGTAACCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATA
CTGCAGCGGCTTCCGAAAGCTCGGGTCTTGCTGCCTTCTCTTCCAGGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACG
CTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGGACCGGAACGTCCCGAACCCTCGGTACGCGTCCCACTTGACCTCACCGGCGTTGCTGGT
ACCGCTGACTTCGCTTCTTTCGCCATCTTCTCTCTTCTTCTCTTTTTTCTCCTCTCGAATGCTCGTTAGGGTAAGAATCTATATGCAACCAAGACACACA
GAAGGTCACACCAATCCCGGGTCGTGGCACCAGTTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCT
TCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGA
GTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTGAGGG
TACCGGCAATCACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATATTGGGACC
GACACTCCTTGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGATTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATC
CCACGCAGCCGAGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATT
TCTCTTTATCCTACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACACATCTCTATGGGAAAT
CGTATAGCCGGCTCTACACAGCCGAGGGTACGACACCGAAGTGGGTACAAACGAGGTTTTTAACCTAGGCCGGGGTTTTATTAGACCCAGCCGAGACCTC
GGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCAGCCAATCAAGACACTCTGTCGCCGTTCACTGAAAGGTGCAACGTCCGCCGGACCT
TGACTGTTCGGCTCCAAAACCCAACGCCACAATGGCATGGCAACAATCGGGTTGAAATGGTTGATCCGTGTCTACAACGGACTGTTCCTCGGAGAGCAAA
TTCGAAACTGAATTGAATTTTAGCCTGTGAGTCTGCCTGTAAAACTACTCGCAGCTAGCTTACGAAACAAGGTTGAAGTACCGAACCCACGAGGCGGTCT
TCAACCTGCCGATCTCCTCCTGAGCCCAGCCGGTGGGCCTTCCGCAGATGCAGCCGGCAGCCTCATTCTCGATACACAAAAGACGCGAAATGATACCACG
ACATATCTCCTGAACCAGGGCTGGGAAATTATTGCTAGGACGGCAGACCCGGCCAAGATACTTCGCCAAGTTGAAAGTCTTGAGTCCGCTCCACTCAGAA
AGACTGAGATTCCACCGACGGACAACGCTCTTGACAAATTATTTGCAGTTCAATGGGTCAAGCCATTACGGTCATCTCGTGCTGCAGCGAAACTTCGAAG
ACCTTAACAGTATAGCATTTTCCAAGCGACAGCACACCTAGCCCGACCCAGACCTAACTTGACAACAGCCTTGGTCGCCTCACAAGAGGCAAAGCCACAG
CACAACCCCGACAGACGGACTCTTCGTTAGGACGTCTCAATACATATCAGGCTTCTATTGGAAAAAGATAATTACCATTAATTTCTAAAGGAAAAAATAA
TTACCAAAGTAGAGCGCCGTTATCCCCTCCCCTGTTAAGGAGGCGACCGGCCATATTCGTAGGCAGAATCCACTGATTGTTTCCGTTTTCAGTGACTTAA
CTCTATACGCTAACGACTTGCGCATGAGATAATTGAGAAATGTGGCCATGCGCTGCCGCTGGAGGAATAGCTGCCACGATCGAAAGACGCCGGTGTACTA
ATGCTGTTGGACGTTCAGTAACAGGGTGAGAGATCCGCAGTGGATAACACGAAGCAATGAAACTCAAGATTCGAGCTTAAGCAAATATGTAGAAGAGATT
TCAGCTGCAGCAACATTCAGTGGATAGGATTGAAGTATATTCCCAAGCCACTTCGTCATCATGGCGGCCATTGCTCACAAAAATGGTTAGGACCGCCATT
TACCTTTCTGATCGCTTCGTCAAATCCAAGAATTCCAGGTAGTACTTGTTGTTCGGGTTCGCTTCTCGCTTAACTGTGGACATACCATCTAGCCCCAGCA
TTTCCTTCACGTACCATTTCTCTCGATTCGCCTTGGCCCAAATCTGTACTTTCACCTTCATCTCCGCTGGGCTGCCTCCATACTCAATCGGGGGCTCCAA
CACGGTGTTCTTGTAATTCCAACACTCATCGTCGTACTTGGTTGCATAACGCACATACGCTCTGAGCTCGTCGCTATTCTTGCGTTGCGCCTTGCTCATT
CCTGCCAGCCCCAAATCGTTCCACACGTCTTTCGTTGACATTCCTTCCGCAAGCCAATTGTCCATCTGCTGACCTTCGCGCTTGTACATGAACTTCTCCA
GTTGCTTGTAATTCGGGTGGGCCTTCAACGCAGTACCCGTCAGCCCGTCCATCTTCAGCGCCTTGATGACCTGCTCGTCAGACTTGTCGACTGTCAGCCA
ATAGTCCATTTTCCCCAAAAGGAAACTGGGGAGCAGAGGGAGAAGGAAGAGACGGAGGAGAAGGCGAGGAAAGAGGTGAAGAAGAAGACGGAGCGGCCGC
CGATACCAGGAATGAGGAGCGCCAAACTGACAGGGGATAGCAGACAAACTGGCATACCGGCATACTACAGAATGTTGACGGAGGAGTAGAAGAGGAGTGA
CATACACGCCCGCTTCCGGAACGACAAGCGAAAGCGAGTGAAGAAACGGAAAATGAGCCAACGACGCACGGCAGGAACCCGGAAAGAGCACGGGTTGCTG
GAGTCTGACCAAACGTTTGGGCTTACGTCACAAAATGTCAATGGCTTGGGGGCAACGGAGGCGGCGAGAATACATTGGTTTCAAGCGTTTGGCGAACACG
ATGCACACGGACGCACCGACGTGCTGGCAATCCAAGAGACGCACGTGGAGGCAGACGAAGTGCAGCGGTATGAAGGGCACTACGCTGCAAGGTGGGGATT
CCGAAGCGACCCGGACCAACAGGTCCACTCATTTTGGGCGCCCTCGACAGATCGAAAAGGGGGGGTTGCGCTTCTAGTTGACCCTTACATATCGTTCAAG
AACGTCATGCCCTACCTGCCGCAGCACTGGTCATCACACTTCATCGCTGTCAGGGGGACATTCGACGGAAAGCCAACGATCATATGCAATGTGTATGCTC
CACACCTGCTCGCGCCCCGGGAAACGTTCTTCGACAGCCTCAGCACTATTGAATTCCCGAAGGATGAGCTGGTGTTCATGGGGGGGGACTTCAACTGCAC
TCTGGATGAAGTTGCAGACAGAAGCTATGTGACTGGTGCTGGAGGCCACGACTCGCCTGCGTTGCGGAGAAGATTGATGGCGTGGGGAATGCTGGACCCG
GTGGCACTGGCACGACCGGACACGTGGGAACCAGCAGACTTATTGAAACATCAGGCGGCGACGCACACTTACCACTACACGATCCCCGGGAAGGGCGGGC
CCTCTTCCAGGCTCGACAAGTGGTACGTCACAGCGGCGACAATGCCTTGGGCGGCAGGATGGAACCTGGCCCACCTCGGGGCGGACGGGGACCACCAGGG
CACCAAACTGCATGTTAGATCGCCGATTGACCCAATCAGGATTCGGCGACCATCAAGGGTTCACCCACCACCGGCTTATGCGCTCAAGGCGGTGAACGCC
GTGATAACGCAGCTCTTGGAGGAATTTAAAGAACAACGACTGGAACAACGGTGGGAGGCGGCGGAGGCTGCAAAAAGATGGGATGCAGTCAAGGCGGAGG
TTGCGAGGCGAACACGACTCTACGTGAGAGAGCGGAAGAAGTCGCTCCGCAATTCCACCAAGCAGAAGCTGGCAAGGCTGATACGGCAGCAACAACGCTT
GCTGGAGGCCACACTGGGGCGCCCAGTAACGATAGAAGCCGTGACAGACGAGCTCGACGCACTTTCGCTTGACGAAGTGGCTGGCACAACGCGCGAGGCG
CGGCTACGCAGGGCCATCGCGGAGTGCAAAAAGTCCCGGGCTGATCTGGGGCAACGCCGGCTGTTCCGTGACAACACGCATTGGACAGGGAAAACGACCA
AGGCTATTTTCAGGAGAGTTTCGACCAAATTTGCTGATAATATCATTCACAAACTGGACGAGGTGCCGGGGGCGCCACCGAGAGAATTACACGAGAAACA
TGAAATCATGGCGGACGGCTGGCAATCCATCTTTCAACAGCCCGCAGCCACCCAAGCGAATATCGAGAAAGTGCTGGAGTGGATTCCACCCAAAGGAGAA
CCGACGGTGGAGCAACAGGCCGCTGCCGCGGTCATTACAGAGGCGGAGGTGCGGACGGCACTACGGGCATGCAAACTTGGCAAGGCTGCGGGCCCCGACC
GCCTTGGCAACGGGTGGTATCGCGAATACGAAGATCTTCTGGTCCTGCTACTCGTCCAACTACTCAATCTGTGGTACGACGCTGGGGTCTTTCCAAAGAC
TTTCCTCGAAGCCGACATCTTCTGCCTGAAGAAGGGCGGCTCGCAACGCAATGCGCTGAACTACAGACCGCTGGCATTACTCAACACTGACTACAAGATC
TTCACCAGGGTCCTGGCAAGTCGAATGAGCATCACGTTGCCGGATGAAATTCACCCCAATCAAAACGGATTTGTCCCGGGCAGAACCATCCATGAGACGC
TGGACCTCTATAAGGCCGCACAACGCATGGTGGTCGCAGATCCTAGCCAAAAAGACGCTACTGCAATTCTCTTGGACTTTAAAAAGGCCTACGACTCACT
CGACCGAGCGTACATGCTGGAGGTGCTCTACCGGAAAGGATACCCCCCCAAGTTTGTGAAAGCGATAGAGCGACTACATGATGGAACGCAAGTGCAGTTC
CTGGTGAATGGATTCAATTCGCGAAGCGTTCGAGTGACTAGCGGCATCCGCCAGGGATGTCCACTGGCACCAATGCTGTTCATACTTGCACTGGATCCAT
TATATCGCAAACTGGATGGTTTCCTCGGTATACGGGGGGTCATTGTACAATCAGCGGCGGGACAAATTGAGCTACGCGTCGCAGGTTACGCGGATGACAC
AGCGGCTTTTGTGAAGCACCCTGAAGACGTTCCAGTGCTGCTGAGGGTCTTAGCGGGGTTTGGGAACGCTTCGGGCCTGCAGATCAACACCAGCAAGACA
ATGGTGATTGCCCTGCGGGCGGACGGGCCGCAGCCGCACATGCAGTTACCAGAGGAACTGAAGTATCAGAGCGCAGCGACGGCGTGTCGGTATCTTGGCA
TCCAAGTGGGAAGCAATGTGAAACCCTGCCGATCCTGGGAACTAGCTGGACAACAATTGCTCACGCGGCTGCTTCTGGCAAGTCAAAAGGTGCTGACGGT
GGATCAACGCAGCATGATTGCGGCTGCAGTCATCATCCCGAAGCTCCTGTACGTAGCACGACATGACTGGCCGACTACATCAGAGGTGCAGCTCATGGAC
ACCAAGATACGAAACTATGTCTGGCATGCGCAGTTCGCAGATGAAGTTTTGGGGACGAGGGCATGGCTAAACGCAGATCTGGCAGCACTGCCGCGGACCA
ACGGAGGGCTCGCAGTTCCGGATCTGCGATCGGAGCTCTACGCGCTAGCGGCAGTGGCGGTCAGCACCTGGGCGGCGGTCGGGACGCACCAAGCACACAT
TGTCGGCGACGTATTGTTTCATACTGGAAAGCCAGGACTCGCACCGAAGGTGCACATCACACCTGAATATACGCCAGCCGGAACTCAAGGGGTCCGACGA
AGCGCCAGTATCTGGCTCACAGGTAGGAAGTTGATAGCTCTGGCAGGACTCCCGGAGCCGACGGCGACAGCGCTAGCGACTAAACGATCTGAGGTATGTC
TCGCCTACAAAGCGGGTGGTATCGCCATCGAGTGGGAGAATCACACACTGAGAGTCGACGCGACAGAGCTGCTGCGGACAATAACGATTGCAAGACAATT
TCCTCCGGGAAAATATGCGGACCGACCGCACATGGAGTGGCTAGCACACGCGGACGTGCAGACACTACAGATTATCTCGAGTGACGGGCAACGCAGATCG
CTGGCGGAGGAGATGGGACTGACAGGCGAGCGAACCCCGACGGTAGTGGACATCGCTGCCTGGAATAGGACGGCCACAGGGCAGGGATGTTTCACGTTCA
ACGCAGCGCATGGTGCGCCGCAAAACCGAGCGCAGGCCGAGAAATTTGCGAAAGCACTGCTCGTTAACTATATGGACCTGCTGACGCGGAAGATATACCC
TGCCGAAGTCAAGTTCACTGCTACCCCAGACCAACACCCGGTGATAGTGACGGTCAGAGGCCACTCCCCGGTGGAAGTGGTCTTCCACACATCCATCACT
GAGGAACCGTGGGTGCAGACAATACACGGCGGGGCAGACTTATGCAGAGTACTTACGGCCAGAATGCGACCGGAACTGAAGGTGCATGAGGTTCACCCAC
ATCCAAGACTGAGCAGACTCGTGTGCTTATGGGCGGGACGCCGCAGGTGGACACGGACTCGCCGTGAGTACAAAGAGCGCGTGGCAGCGGCGAAACGACG
TCGAGGGGCTATAGACCTCGACGGCAGGACCAAAAAATGGCAGGAACGGAGCCCACAACTGGCGGAAGGGCTTGCACTACTCGAATGGAAACGCATCCGG
AGAGTAGTGGGCCTCAATCCGTGGGGAGAACAACTACTACTGCGCCTCAAGCTCAGAGCACTCTCGATGTTTGACAGGCGACACGACAAGATCGGCTGCC
CACATGAATCCTGTGTACACTTGCTGGACGTGGATCTGGAACACGTCTTCTGGGGATGCCCAGCGACGCGAACATTACGGAGGCACCTACTCCAGCCATG
GCGACAACTCGGACTGACAGACGACGGACTGCAGCAGGAGGTATTCGGGATGCAACTTACGAAAATACCGGCAGGCGTATGGGGCAGCATGGCTACAGTA
CAACGGGAAGTGATGGACTTGCGCCCTCAGATTGCGGAGGAGGTGACTTTGCTCGTTGAGAGCAGCTGGCGCATTGGGGTGGCCATCTATCTCCACGCAG
CTTGGCGGTGGCGGGTCTACCACTTTGACGAGTCGAACAACATCACGGAAGGGCACCACGTGGCACTCCTTAAGAAGCGGCTGCGAGAGGGTTACAATAC
TGTCCAGGCACACTTACGGGCAGCGCCATCACTAGTAGTTGGAGCGACGGCGGCGAAGATCGTCGGTAGAGCCCTTCACTCGGGGGGGGACACACTGCCA
GCAGTGGATCACGCCGAGGGAGGAACCAGGTACATACTGTACGTGGCCGGACGGGTGGCAGGAACAAAACGATCAGGAGCTTGCGGGGCGATCATTGTCA
GCTGTAATGACATATCGAGCGGGGCCAACTGGAGCGGGCACATGTCATACGCCAGCTCGTCACCGACGACCACGGAAGCGGAACACTTAGGGCTCCTCAT
GGGACTCAAGGCGTGCGAGAAGAAGCGGTACTGGCCGCTATGGGTGGTGAGCACGAACAAGATGCTGATTGCACAGCATCGGCAACGCAAGCCCCCAAAG
GCACGGCATTTAACAAAAATCTACTGGAGGAGTCGGCGCATCGTGGATCGGCTCCGGGAAGTAGAATGGCTACACCACGCCAAAGAAGCCAACCGTATGG
CAATGGAGCTAACAAACACAGCGCTCGAAAGCAGAACGAGCGTACAACAGTACACGGCTGACACGGGCACCGATTCAGGGAAATGGAGGAAAGTACTCCG
CCACCTAGATGGAGACATAATACAATGGAAAACACACGAGGACAACGCGGCGCAAGCGGACGTCGTGGCCGACAGTCAGTAAGGACACCGGCACGTAACG
GGGAAGCGTAAGCTAGGACCTGGAGAAGGCTAACTACCGACATAGGGGCGATGGTTAGAACGGACATAGGAAGTCGTTAGCACCACTAAGTGACATCAAT
GTACCTCACTGAAAACTAAAAAAAAAAAAAAAACAACAAAAATGATTTGTCATTTCTTAGAATAGCGACGGTGATCTGCAAGGGCAGAATCATTAACATA
GCTCGCCCGAGGAAACATATTATGATGGGACTTCTGGCTTCACCTTGTCCAGCGTGACTAAACACCAGTAGGTTCTACTGGGTAGACTCATACGCTCCTG
GCCAAGTTAATTCGGCCTCCTCATAGCTTGGTGAGTTTTAACATTTAATGTGCAGTTTTGACGGGTTCCAAAACACGCTCGAGTTGAGTTTGAAGTTTGA
GTTTCGGTTACTGTCCTCTAGAAACCTTGTATGTAGTGAGACGTGACTGTATCTCTGCAATGCCTTCCTGGCGAATTCTGCTGTGAGCACGTGTCGGCTC
TTTCTCAGCCAAAACCGCTGAGAAAGAGCCGACACGTGCTCACAGCAAAATTCGATGAGGATGTGGTTCTCCGGGCCACCGGGGGCCAGGATTGAAGTTA
TTCCCAATATGTATTATACTAGTAGTCAGTAGAACCTACTGGTGTTTAGTCACGCTGGACAAGGTGAAGCCAGAAGTCCCATCATAATATGTTTCCTCGG
GCGAGCTATGTTAATGATTCTGCCCTTGCAAATCACCGTCGCTATTCTATGAAATGACAAATCATTTTTGTTGTTGGTATTTCTCTCCTCTCGATCGACT
TCACTTCACAACTGTCCAGGTAACCCTCGCATCGGCGCCTTCCTCCCATGCGTTTCTGCAATGCCTTCCTGGCAACTCTGTTGATCCTCCTCGCGATCAC
CGTGGCCGCGGAAAAGTCTACCCGATCCAGCAGCATTCCTGACGTCGGATACAACCGTGGAAGGCTACTGCGAAAGACTGACACTGCTAAGGCAAATGCC
ATCGACACGGAAGAGAGGGGCATCTGGTCGTCCATCAAGAATTGGGGGAAAATGCAGTATTGGCTGGCAGTCGACAAGTCTGACGAGCAGGTCATCAAGG
CGCTGAAGATGGACGGGCTGACGGGTGCTGCTTTGAAGGCCCACCCGAACTACAAGAAACTGGAGAAGTTCTGGTACAAACGAGAAGGTCGTGATATGGA
CGGTTGGTTTGAGGATGGAATGTCACCGAAAGATGTGTGGAGCGATTTGGGGCTGGCAGGAATGAGCAAGGCGCAGCGCAAGAATAGCGACGAGCTTAGA
CAATATACGCGTTATGCAACCAAGTACGATAACGCGATTTGGAACCACAAGAACAGCATTTTCCAGCCCCCGGTTGAGTATGGAGGCAGCCCAGCGGAGA
TGCATGTGAAAGTACAGATTTGGGCCAAGGCGAACCGAAAGAAATGGTACGTGGAAGAAATGCTGGGGCTGGATGGTTTGTCCAAAGCTGAGCGAAAAGC
GGACCCGGACTATGAGTACTACCTGGAATTCTTGAAGTTGACGAAGCGATCGGAAAGGTAAATGGCGGTCCTAACCATTTTTGTGAGCAATGGCCGCCAT
GATGACGGAGCGGACTTCCAACATGAAACGTGACATTGTTTACAGAATTGAGTTTTTTGTCGCTTACCAACGCAGCTTACTGAATAAACAAACTTTCGCA
CCAGAAAATCAGCGGAAATGCAATTGCAGTTCCAGACATAGCGCCCAACTGTGTAGCCAAACCATTCCATTGATACACTCGCCGCGCAAAACCCGTCGAG
TGCTTCACGTCTACAATGATAACACAAAAGAGTGAGCCAAACTGGGAACAACAAACAATACGTTGCACTACTGTAGGATAATGCTTTCTGCGGCCTACCT
CCAGCTCGTTTCAGCGTCAGATAGAGCATCGTCTGCGTGTACGCACATCCAACGAGGTAGAATATGTGGACGAGAAGTGCTGCGCAAATGGATAGGGCCA
CATGCACGATTGTTAATGCAATACTCATCGATCCAAAAATGGGAGTTCCCACACATGGCTTACGCAATAAATATCCATGCTTGAGATCACTCAGGATCGG
TCTGGAGGTGAGCGAGAACGACAGGAGCAGCGACTGAGGGACAGAATGACAGCAAGTACATTCGTCAGTTTACACCTCGCTTTCCCCAAAATGCAGTAAA
CCCACCGCAAGTACTACCAGCACGAGAGTCATACTCTGGACGTAATACAACCGCACCCACCTTTCCGTACAACGTATCACAAAGTTAGCAATTCCTTAGA
CACCTTCTGAAATGGGTACTTACGTTGTGGCCACACTAGCAAGTGGAGAAAGAATTAGCGCTGCAATACTGGCTGTAGTCTGGAAACGTGCTGTCATCGT
CTCTGTATTGTCTGCCGGCTACGGAACAAACATCATCAGATGAAGCTGACTGAGTACAGCAGTCGCTTTTTGACAGTTCGTTCGACGCACCGCAAACTTC
TTGTACACATAGGGCATCGTAGATGGTAGCCACCCAAAAGAAAAGGCGGCCAGCACCCACTGGCAAGCCAACAATGGCCATACCTGTCGAAATACCGCGG
CCCCAGACATCATTTCAGCGCTTTCCAGCTCCGTCGGTGCAGGAATCGTGACGGTACTTGCACTCGTGGAGCTGGGACAGCTACCGCAGGAGCTCCGACT
GAGCAGCGTGTCCTCCTCTGCTTCTTGCGCAGCCCGTTCATCCAGTTCCAAGGCGCGTTGCTTCTGGTCCTGTACCGACCCATTTGTCGCAGCCTCCATC
TCTTCTGAAGCCTGCACCGCTTGTGCCCACGGATGGTACTGCAAATACGCAAACGCAGCGAGCGACACGCTCATAATCGTAGCTGCCACAAAGCACTATC
GGTCTCAGTACCCTTCACCGAAAGCCACCACAACCTTAAAATCCAACTCCACCCACCACAAATAAGGTAGAATGTCGACACGGAGTAGCGCAAGACACCC
CCAGGGTCTTGCACAATGCCCAGCAACGCCGCTAAAGACCCACTGAGCCCCTCCCCCGTGGACAACGCGCTCGTAAAGAGCGGCGGGAAGTTTCCCCACG
AACGGGTAGAACACCACACTGGACGTCGTGCTCACCATGCCCCCGAAATGTGTCAGGACCAGCATCGCTATAAGCTCAGGAGTAACGAAACAGTCAGCAC
TCTTGTCCTCTCCACCACTGGCAGCAACTGCACAGCACTGCAGGGCAGCGTACCGACACTGTGTCTCGATCCAAATACATTGGCCGTTTGGTCCCACAAG
AGACTCATGAGCACCGCTACCACCACGCCTTGCACCAAAATCCACCAAATAACGGTGGACTGGCTCAGCAATTGCTGCCGAGCATTGAAAATCATGTAGA
GCATCGGGTAGATGTTGGCCGACTCGAGTGCGAGGATCTGCAGGCAATAATTGTCAGCAATTATGAGTCAACCCGTCATGTGTCCTTTCATCCTGTCCGC
TTTGACTGTACCGAGTAGGCGTAGATACTGTAGTGCTCCGGTAACTCGCGCAGGAACACGCCCAGCTCCACGTACGTTACGTTTGTCATGATCCATGACG
CGAGGCCAAAGCCCACGAAGGCCAGAAACGTGACCACGCGCTGTCGCTGGAGTCGCAGCTGTCGTGGCCGAGAGACGCGGGTGTCCTGAAGCTGCTGGAC
GTTGGTCTTGAGCGGCTGCTGCTCGCCATCGTCCAGGGACATCATCTTGCAAAGAAGTAGCGCTACCACTTGCAAAATGAAGGGTTAGGTTTATAAAAAG
ATCCTAGTATTTATTGGTTCACCTAGCCCTGAAAATATTGCTGTATGCTTTGCAAATCATAGAAAATTGAAGCTGCTTCCGACTTACTTGAGGTTTGTAT
TGAAACGGTGTCAGAAGCAATTTTCCCAGCCCGAAGCAATAAAATATGCAAAACCGGATTGCACGGCCAGTCAAATCGAAACATTTTGTCAAATTTTACG
CCAATCAGAATGTGATTCAAAGCATACATTTTCCAAGTTGATGTATTGTGCATGGGGATCGGCACTGGACCTCCTCCATATGTGCGACAGTACTTAACCC
TTTCGTGCAGGCGGGAAAACTCGCGGTTTTCACTCAATCAAACTATACCATACAAGTCAAGATGTTAAGCAGCGAAACGGAGCATGTTGTCCCCTTTCAT
AAACCACGGTACTCGCCTAGAAATAGTCCTTTCTGGATAGTGGAAGGAGGATGGGATTTAGGAGGGCTTGGTCGCGAAGTTATGATGAAAGGGGGCATTT
TGCCCCCTTTCATACGCCACGGTACGACCGCACCTGGCAGCTGGTCATTTTTCTGATTGAGCTAAAAACGGTTTCCACCGCTTTTCTGACGATCATGGCA
CTTGATTGGCTGTTCGTCCGACTGGCGTGATGACGTAAGACGGCAGATCTTGAACCAGATCCCGTAAGATATCAGGTCCCACTTGAAATCTATCGGCGTC
AGCCATCCGTGTGTGAGAGAGGACAAGAGTGTCCGACATGCTAGCGAATTGCATGAAGTAGCGAAGCCCGATACCTGCACCAGCGATCGCCGTACTGTTG
GCGAACCTGCACAGATATTACTCTTTTTCAAGAGTTGAGTGTGCGTAGTGCGTAACTTTTCATCACCTACTGTACCAAGCTGGCTGCTCTAGCAGTAATT
GGTTCACCCAGAGCGATACGCAAATACATCGAAGTGCGGAAGACACGTGAGGCGAGCTGATCCGGAGGGAAATGAGTCAGGATCGAAGCGAATTCACGTC
GCGTGCCAATGTCGTCCAGACTGGAGGTCAAGGCATCCAGCCGGAGTGGGTCTTGCCGCGCTTGCAGGAGAAATTGACGGGCGCTCATGTCAAACAGACG
CTCGAATTCAGAATCGTCGTCCGCGTTCATCTCCTCGAAGCCAATCAATGCTGTAGTGCCTCCATACCCATTCATCGTGAAACCGCAGCCGCGCGTGTCG
TCCACCGTGGCTGGAACTCCCACCAAGTACCGGTGTCTGGCAGGGAAGGCAAGGTCCAGCGCGCCGAAGAGTCAGGAGGCGCAAAAGTCTCGCGCCGAAC
AGTTTGCTGTGACAGGACGCCCTTGTAAAATAGCGCGTCGACGTCTTCCATCCGCACGTGGCGTGGTCGCGAGAAGGAAGGCAACACGACACCCTCGCCC
ATCGGGATGGGGCTAACGCCACCGCCACCAGCGTTTGCGCTCGCGTCCGGGGCGTTCTCAGTGCTGTTGTCACCCTCGGGCTGACGCAGAACGATCGCTT
GCGATTCAGCGCCTGAAAGCTGGCTCGAGTCTTCTGGGGGGCGCATCTCGACGTCGCCGTTGCCTGGAGGAGAAGCAGAAGCTGGAGGAGGCTGTGTACT
GTCGCCGCTGGCGTCGAGGAAGGCGCTGGGGCCGGAATGTTGCTGGTCTCTGCCATGTTGACAAGTTGGGAAATCGCGATATGACCGCGTATTGCACGTG
AATGCTGTGGTATCCGGGAGGAGAACATTAATGATGGATCGTGACCGACCGTTGGAGAGACAGGGTACGGCAATGTGCTGAATTCTGGCAGACGGCAGAG
TGCAACGGCAGCGTTTGATTCGATTTCTTGGGTTGGCTCCCGTTTGAATGTCCTGGCCATGATTCGCCAGCTCGGGGATATTTCCTCTCTGATGGATCTG
GACCAGGAGGGGCGGTTGACACGAGGTGTTCCTGGTTTTTCTGTGACGCACCGCCGTCGCGACTCTGGTCTAAAATTTCGAGCATGGATACTATTGGATG
AAATGGAGAATGACTCGGCTGTACCCGTGCGACACGGGTGACGTATGGAGTGCGACTGATTTATGGAAAGATCTTACGCCTAAGCACAGATGGGCCCAAC
TGGCTGGAAGTGTGTATCCTGGATGTGTACAAATCCACGATTGCAAACCCGCATTATGTCCAGCCCCCGGACTTTCCCTCACGATGAGTGCCTAAAGCCT
GGCGGAAAGTGCAGTTGAGAACGTATCTCAGATTGTACCTCATCTTGCTGTGGTTCAGAGTGACTACTAAAGATACTGAACCAAGATCATCCACTACCAA
CACCCAAGTCGTGCGCTGGAAGCCCAAAGAGTCTGGATGTCAAGTACATCCTGAATCCTGAATCCTGACTCCAGAATACCAGACTCTTGACGGTTGACCA
CTGACTATTTGACTTCGAAGACAGTGGTACGTCATCAAGTGAAACGCAATTGAACTACCGCCAAAGAACCCAGCAGAACTGTTGAGTCGACACTTTTGAA
GCTACGAAGACAATGTACCCAGACCATACTGAAGCAAAGACAATTTGACCCAAGCCATAGTGAAATCAAGATAAATCACCCAGAGCCGAGATCTAGAAAG
AATTGATAGTTTAAGGATTACAGTCAACAACAGAGTTTGTTTTACCCCGTTCTGCGCAAGTGAATTCGGCCAAGCCTGCCGACGGAAATCCGGAGGACCC
GAGACTACGACCGCGATACAACAAGGGGCGCTGCGACCATTAAGGACGGGTCGTCTGTGGCATCTCCACCTCATAACATCAAGTCCAGTTAGGTGGTGAC
CAGAGGCGCTCCGGCACCCTGGGTTGACCCACCTATTTCATATTCTAGTTGGGTCACTAGCGTGCTGGTGTTTGCCCATTTCATATTCCCTTGCTATTCG
AGGTGACTGACTAGCAGTTGTTGTAATGGGTCTGCTTAGACCCACTACTTAAGCATACACGTGTGCGCACGTGTAGG