Description :
From Genome Similarity Track
Location :
contig_166:11742- 12939
Transcript NameFunction/comments
g14520.t1hypothetical protein

Sequence
1197 bases(100 bases per row)
AATTACTTCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGGCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACG
CATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGT
TGCGAACGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGC
CACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTAGAAGAGAGGGGGACCTCTCCTCCGTTGGCGTGTCAAGGTCGACACTGCCATTA
CGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGA
TCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGAT
CTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCG
TCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGA
AGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTG
CGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGT
GCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATG