Description :
From Genome Similarity Track
Location :
contig_59:117417- 118866
Sequence
1449 bases(100 bases per row)
ACATGAAGGTGATCCGGACGGACGGCGGTGGCGAGTTCCAAGGCCGCGAATTCATCGCATTTCTAAAATGCCACGGAATTCGGTAGCAGGTGATGCGCCC
AGACACTTCAGCATCCAATAACAAGGTGGGACGGATGCACAGGACGCTCATGAATGCTGGTCGTGCTATGTTGTGAGCTTCCAAACTGCCGGAGCGATAC
TAGGACGATACAGCAAAATATGCCTCCATATCTGGAAACACATTCTAGCGAGAGGGAATGTCGATTACAAGACGCCACTGCATGCCCTCACGGGTAAGCC
GCCGCGGGTGGGGTGCATTCTGAAATTTGGTTTGCGATGCACGATGCATGTAGCTCACAAGACTGGAGTCTCAGTGAAGAAACGAGCGGAGAAAGGAGCC
ATCATCGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTGCACGTTTTTCGATGATCTCGGCGAATATCCCTCGCAATAAAT
TAAGCTCCCCTCGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAACAAAAGCACAGTTAGCTAGCATATAGCAGTGAACACACAATTC
GATAAACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCGAAGTAGAGCACAGATGCGTGTGGGAAGCCGACAGTGGCTCCT
GCAAGTTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGGCGAGGGCTCGTACCACTGGTATAGCGACCGCTTCGTTAAACA
CCAGTTTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGTTGGTAGCAGGGTTAGAGTTTCTCCATATGCACAGCTTCCCGC
TGACCCTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACACTCTCAGTTTGGACTGCAACGTATTCTTCATTGCGCTCTCAA
AGGGCTTGAAGACGGCAACATCAAGTGGTTGATACACGTGCGTCGCATTATCGGCAGTATTACCTCTAGTATCTTCATGTTGAGTGCTGCTCCATCAGAT
TTTACCCAGCACTAAGGGATCGATTTTGGTGAAACTTATTCTCCAGTACTCAAGATCACCAACTTGCGTCTGCTAGTTGCGCTGGCAGCAGCTTGGAGAC
ATCGTTTGCGACAAGGCCACGTGCCAAACATATATGTCAAGGCCACATTGTATTGTCCGACGTTGATGAAGGCCCCTGCGGTACGTCGGAGGGCAATCAC
ACTGCATGACTGCTGCGGAAGTCACTTTATGGTTGAAATAGAGTCATCTTCGATGAAACAAAACGGTCAACGCGTTTTTGCTGCCTTTGGGAACTGTAAG
AATCCGCTCCCTCCTGGATTCTTTGCGCATCCCTAAAGTACCTCGCACT