Description :
From Genome Similarity Track
Location :
contig_59:117408- 118411
Sequence
1003 bases(100 bases per row)
ACAGAGTCAACATGAAGGTGATCCGGACGGACGGCGGTGGCGAGTTCCAAGGCCGCGAATTCATCGCATTTCTAAAATGCCACGGAATTCGGTAGCAGGT
GATGCGCCCAGACACTTCAGCATCCAATAACAAGGTGGGACGGATGCACAGGACGCTCATGAATGCTGGTCGTGCTATGTTGTGAGCTTCCAAACTGCCG
GAGCGATACTAGGACGATACAGCAAAATATGCCTCCATATCTGGAAACACATTCTAGCGAGAGGGAATGTCGATTACAAGACGCCACTGCATGCCCTCAC
GGGTAAGCCGCCGCGGGTGGGGTGCATTCTGAAATTTGGTTTGCGATGCACGATGCATGTAGCTCACAAGACTGGAGTCTCAGTGAAGAAACGAGCGGAG
AAAGGAGCCATCATCGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTGCACGTTTTTCGATGATCTCGGCGAATATCCCTC
GCAATAAATTAAGCTCCCCTCGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAACAAAAGCACAGTTAGCTAGCATATAGCAGTGAAC
ACACAATTCGATAAACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCGAAGTAGAGCACAGATGCGTGTGGGAAGCCGACA
GTGGCTCCTGCAAGTTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGGCGAGGGCTCGTACCACTGGTATAGCGACCGCTT
CGTTAAACACCAGTTTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGTTGGTAGCAGGGTTAGAGTTTCTCCATATGCACA
GCTTCCCGCTGACCCTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACACTCTCAGTTTGGACTGCAACGTATTCTTCATTG
CGC