Description :
From Genome Similarity Track
Location :
Scaffold_356:1174- 3238
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_356-snap-gene-0.12Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_356-fgenesh-gene-0.3U2 small nuclear ribonucleoprotein A'

Sequence
2064 bases(100 bases per row)
TCGGAGACGATGCATATGCGTGCTTTGTTTTAGCGTGACGGAATAAGCTAGGGGGACTGACAGGAGTTTGGATACACAGGGTGAACTCGACGATCCATGC
CGTGGCTGTCGTGATTGGCGTCGCTGTCGCGCTCTCGTCGATCACGTGGGATAGCGAATTCGCTCCAACGAGCTCGATCCGATCCGCGAGCTTCATCTTC
TCCGTAGGTGCGTCCATACTTGGCGTTTATGATGCAATTCAGAGGTGCGTGGTAGAAAGTGTCTAATCCTATATCCTTACTCTCGTTGTGTTTCTTGTTT
TTGCAATAGCAATTGGATACTTTCTGTGTGATCTGATGATTATTATCATCTGGCCCGTGCCCATGCAGTATGTGTTCATCACCCACCACATCGTCGCAGT
GTACGTTGGAAGTGCGCCATTTAGCAGTGTGTCTACAATTGCTGACTTTGTTTTATGGATGTTTGCATTCCACAGAGTCCCGTACTTTATCAACAATTTC
ATCTCGTGCTGCGCGGCGTCCCAGTACGGTCTCTTGCTGTACCTGCTCGTGGAACTGGCGACGCTCCCACTGAACGCGCGCGGGTTCATGGAGTCTGTCG
GCCGTGAAGATACCAAGAACCACACCAGATCAATCTACGTCACGTACTGGGTGTGGGCAGTCACGCGCACAGCGTTACCAATCTACCTCCTGTACGTGGT
TTGGAAATATGCGTACCCATCGGACCGCAATCACGACGTGTGCTTGTACACGAACATCGTTGGCGCGCACGTGATCTCGCTATTCTGCGTTGGCGTGTTC
CTCTTCGTGCACACTCCCGAGATCCTTGCGCTCCGGAAGGCGCGNNNNNNNNNNNNNNNNNNCGCGAAGGCGAGAGAGGATGCACTGCAAGGTGGTGACA
ACAGCGAGGACGAGGACGGCGCTTCAGTGGATCCGCCCAAGTCGTGCGTCAACTCGCTGACGATCTCGCTGTCCAGACGCAACAAGGAGACCATGGTGGA
CGACTCGTACGACGATGTGGAGCTGGGCGTGCTGCCTCGAAGCGCCCGGGCATCCTGATCCGCGCCACAAAGATCTCGTTTTTTTTCCCTCGTCTCACCC
AGTTTGGAGATGCCGACTGATTTTTGCTTAGATCAGTAGGCTCGGAACTGGGTACACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGCTC
CGTAGAGTAATCCGCTAGACTGCATGCTGTAACCTAAGTCGAACTTATCCATTAATTGGCTATTTTTATAATTAATAGAACTCAAACTTAATGAGCTGCT
CACAACATAGAACGTATAGACTTGTATTGAGGAGGGTTACGGTGCCCGCATGCTCTTTTATTTTTTGTTCGGCTCAGGGGGTTATGCACCACGCAAAACT
TTAGGCTCGAGAACAGATAGCGAGGCGAGATGCGGCTCACAGCGGACGTGATTCTGCGCGCGCAGGTGTCCATCAATCCGCTCCGCGAGCGAGAACTCAG
TCTGCGAGGTACCGTGCGCGCGCTTCCACTCCTGCTTTGTGTGTTTGTTGCTGACATCTCTCGCCTGTAGGCCTGAAAGCGCCCGCGATCGAAAATCTTG
GCGTCACCAAGGTCCGTACGCGCTATACTGATCGATGGACATGCGCGCAGCTAGTGATAAATGAACAAGCGCGCTCATCGCGTTCATACAACGCTATGTG
TATTATTTGTATTATGGAACGTACAGGACGGATTTGACTGTATCGATCTGTCGGACAATGAGATCAAGAAGCTCGAGAACTTTCCGCGGCTGAAGCGGCT
GCGTATGCTGCTACTGCACAACAACCACATCGCCAAGTTCCAAGACAACCTCGCGGACTCGATCGCGAATCTGGAATATTTAATCCTCACAGGCAACAAG
ATCGCGCAGCTCGCGGAGATCGATCGCCTCGTGGGCTTTGCTAAGCTCGACACGCTCGTGCTCGGTGGCAACCCGGTGACAAAGCGCAAGTACTACCGTG
AGTACGTGATCCACAAGCTCCCGCAGCTCAAGGTGCTCGACTTCAAGAAGATCAAGCCGCATGT