Description :
From Genome Similarity Track
Location :
contig_7:117387- 122402
Transcript NameFunction/comments
g2004.t1hypothetical protein

Sequence
5015 bases(100 bases per row)
CGGCTTGCACCAGCACACCACTTAGTATCTCTCCATAACGAATTCAATGCAGTTTCTCAATGGTTAGCAATGCACGACTCCCTATCAAGATGATAGACAT
CGAGGGGTCTCGCCACGGATCTTCCATGAAGAGTCTCTTCATCCCTGGGGCGGCGTTCCTTCCCATCTTGAACTGCTCGGTGATACTCGTCAGCCGCTAC
ATTCTTCGACGCCAGTACTCGAGTTCTCCCATAGGACCGTCGTCATCAATCGTCTGGTCATTGTTCCCTTCGCCGTCATTCGTCGTGTTTGTCTCCAAGT
AGGTCGAGATGACGTCGCACCACTCCTTCAGCACGTCTTCGTAGTGTGCGATCAACTTGGGCGGGTCGGAAGCCTGCAACGCCCTCGTACCATTGACCGC
ATGACCTGCACTGCTCACGGTCTCCGCAAGGATACTGCGGTCGGGTCTTCTCAGCTCCAGGCCACTGTCCATACTATTGAGCGCCTCCTTGAGGTCGTTG
GCGAACTTCTCAGACTCCGTCATGAACTCGTTCTTCAGATCGGAATCTGCTATCCCCCACTCGTCCTTCACCTTCTACAGAACGAGTACATTGACGTCTT
CGCAGTGCTGAGCCGAAGGACGAAAAGCGTCAGTGACGACACGAAGCGGCGCATCCAGACTCTGCTTCGGCGGTGGAAGCAGATTGACATCGGCATCACA
GAGGCAGCCAACGAAGCCAAAGACAACGTCAAGTACCTGTTCACGCTCGAGAAGTTCATCATCCCGCTGTACAACGGCACACCCAGCTCCATCATCGATA
CGCTCCCGGCGCTGATGAACTCGATCAAGATGATCCACTCCATCGCGAGATACTACAATACTACCGAGCGGATGGCCAACTTGTTCACGAAGATCACCAA
CCAAATGATCACCAATTGCAAGCACTGTGTGACGGGGGGGGGGGGAGACCTACGAAGTCATGTGGGACAAAGACCCGGAAGAGCTCGTGCGGCACCTGGA
CTCGTGTCTCAAGTTGAACGAAGCCTACCAGCAGCAGTATCGTGTCACCAAAGACAAGCTATTTGCAACACCCAAGGGCAAGCAGTTCGAGTTCAACGAG
ATGAAGATCTTTGGGAAGTTCAACCTCTTCTGTCGGCGTGTTATGAAGCTGATCGACATGTTCACAACGATTCCACCAGTTCTCGTCGCTGGTTAATAGT
GGTGGGTAATCTCTCTATCACGGAAAATAACGTTATTGGGGTTAAAAAGATATTTTTAGCGTTACTTTAATACTGTATGATATTTGCAATATCATGAACA
TGTTTGGCTATATTTGTGTTTTTGGCATTGTAAATTACTCAGCCCGCCAAAGTCATCTTGTGGCACATTCGCCGACTGCTCTGAGCTTCTTTCTGGCGGT
ACGCTGTCGCCTCTGTCCGGCGGTTGATCTGCGTCCGGTGCCCGAGCCGGAGGTGGTCACAGGTTCTAAAGCTGAAGACTAGTCATTGTGTACAACGAGA
TGACCGACCTGGTACGGCATCTGCCACGCCGGGACGATCCCCAGTGCGCAGTGACGCCCAACGGCGCGACATCCCAGCCCATGGACGTCACGGCTCTGCT
GTCGGCGGCACCGTCTCGATCAACTCGTACGGCCGTCACTTGAGTGACTCGTACCGTGACCTGAACCCTGCTTACTTCCACATCGCCGCTGTGATCCTGC
TGGGCAGCCTGAATTCGATCTTCATCGTTGATGTCACGGCCGGTTCGGAGGTTTTAAGATGTGCCGTGTTCCTAGAAGAGGATGCCCAGACGGCTTGGAG
GAACAACCGTAGAGCTCGGCTGCTAAGAGCACCATGTACGCCAAGACTCGTCGTCTCTCGTGGATTTTCGAGACGTACACTGATGGACCTCTGGTGCCTT
CGGGCTCGTACACGACGGGTGCTTATTACTACTACCTGCTTGAGATGGACGACGCTGGAGCCATCATTGATGGTGAGTGGGTGTACGACTCGGACGACGA
CCACCTGGACTTCCGGTGCTTCCCGAAGGCCAAGCCTGCCGCTGATACGGTGACCAGCATCAGTCGAGCTACGCTGACGTGTCCATGCTGGCCTGCTCGG
GTTCGTCGTCGGGCTATGAGGCTGTCGGCTCGTCCTCTACTTCAGATCGTTGTTCTCGTGAACCATTATGAAGTGGTTTTACGGTGGAACTAGATACAGC
GAGTATATCTCTTCTACGCGTCCTACTACAGTATATTTTCAACCACCACTACAAATTCTGATCTTTGGCAGGGTTCTTTCGGGTTTCCCTTACTGTTATA
ATAATGTGATCCAAGCTGAACAAAGGATACATCCAAGAGTGTGAAAGACTATCAAGTTTATTAAGAAGTGAGTAAACTGCCGAATGAAAGCCGATGGAAA
CTATTCATGCATGTGAACGGGGCTTAATGTAAAATGCAGAATTATGCCGAAACATAGCCTGATGATGTTCAAGAAGGCTTGCCATCGCGGAAGTCGAGCT
CAAGAAGGTTGATTCTCCGCCATGAATACAATGTCGCACACTGTGTCGGCAGTGAGTGCACTACGCCGCTTGGTGACCACGTTTCCTCCTGTGGATAGTA
CTCTTTCGGAAGGAACTGATGTCGCGATGCACACAAGCTACATCAGAGCTAATGGAGCGATAAGTGGAAACGTCTTGGCATTGCCACACCACCAGTTGAG
TGACGACGGCTGCTCCTGTTTCCACTCGTTCTGCTGATGACGTCCGCAAGTAGTTCTTGAGTTCCCAGTTACACTCCTTACCAAGCGACCTAACGTCAGA
AGCAGTTCTGCGTGATGTCAATCGCCTTCCATACATGACTCTCTGAAAGGTGGCCGGCTTGAACGCCTCCCTCCGTCGGTCGAAGTCCGATCTGCGTGAA
TGCTTCCCTCCGACCAGGTTGAAGTTCCGCTGAATCAGCGTTGTTTATGGCAATTCCATACAGCTTATATGTGGTCTTTCCCATTTTCAAGAACCCTGGT
TCGGTGATTGGCTTGATCTTGACCAATGAGCAAGCCTGTTAATTGTGTGTTATTCTGAGCTAACCAACGAACTCGGACACAATTTAACTGTGAAAAATAA
AACGTTATTTAACGTTAAAAAGTAAAGTTGACACCCTAGTCAGTACCGATGGAGGACCTTACCACCAACTTTAATTCCATCATTCGCGAGTTCCAGTACC
GCAATCACGACTTGCTCGACTACAATAACAACCGCTTTGATCGCGACTACGTCGAGTTCAACGTGCGGATCTCCGACCTTGAGGGTTTGCTGCAGAAGTT
CATCAACGATTCTTTCGAGAACATCACTTCGATCTAGCACTCTCCGAAGTCTGAGCCCGAGGCGCCCTCCAGGACATTGAGTATGAGCTCACCAAGCGAT
GTTGGAGGGGTCGCAGGGCTCGGCGATGAGTTTCAAGGACAGAACAGCGACACGGAACCGACAACGGGCAGAGCAAGCGGAGCGGCGCGGCAGGACGAGA
GGAGCGACGAGCAAGCTGGGCTTGGCTCTGGGATGGGTACAGCACTTTTGCGAAGCATGGCAGCCCAAAGCGCAGCGTCATTGGCGTCGAGATCCGAGTT
CCGGTCACCAGATCCATCAAGAACAACCCCAGGTGAGGTTACCGGTGCGTGAGGAAGTGAGAGTGAAGCAGGGAACGTACCAGGTTGACGACGCAGGCAC
AGCAGGCTCCACAGTGTCTCTAGGAGGCGACGCAATTCCAGCATTAAGCATCGCAGGGAAAATACCACGACCACCGAGGGAGCTATCACAGCTCTCAAGA
TTCAGGCCGCTTGGTAAGCGGCGTGAGGAAGGAGGGTCAGACGTATCCTCAGCAGTAGCGACGTGAGGCGAGGCGGTTGAACGCCTTTATTGCCCAGGGC
GTATAGCGCACGCGCGCCAGAAGACTCGGCCGATCAGGAAGCTTAAACTTCGCCTTTCGGAAAGCCCAATGGGGTCAGACTACCTCCAAAAGTACGGGAC
CTCCGGAAGTAGCTTGGCGTGTGACCTTGTGTAATGCCTATAGGTGTCGTTTGTCTTCGGAAGACCGGACTCCACCTGATGAGTTGTTCCTACACAATCA
AAATGAATACAAGAATACAGAGTGCGTACGTTCACTTCTCGACGCAATTAGTACAGCTGGGGTTAGACCACTAGCAAAGCCTTCCCAGATGACCAAATAA
TACAGAGAGTTATACACAATATGCAGCTGCTACTTATTCTTTTGGACCCTTGAGCAGTGGGTCCGTACACCAGTCTACTTGTGTTTCACCTGGAAGACTG
GTCACTTCCAGATGCACCCTTGTTGCGCACCACTTCCAGTAAGGAGGATTTATAACTCCTTCCAGAAGATAACTTTCAGATATATCCAAAAGGAAAACCA
CTTCCGGATCACTCAATATACAGTCCTATCACACAGCAGTCTATTCGATCAAATTCCGGGGGGTGACTACTAACAACCTCCTGAAACGGCAATTACTATG
AAATGGGGGTCTAGAGGACACACTCCCAACTGAAATATGAAATAGGACAGATCACGTACGAATGCGCGTCACTCGGTCACCGCCTAATTTGGTCTTGAGC
CTTTCGGAGAGTTCCACGGCGGTCTTCGCGATCACGACGCGTCCAAACGCAGGCTGGGTAAACCCGGGTCCCCGGAAATCATGGCGGCTTGTCCGGGGTT
ATCCCAGCGTGCTTCCAGGCCAACTGATAAGGGCCCTGGAAAACACTTGCGCCCTTGGTGGCAAAACGTACTCTCTGTTATTTTTAGTCTCTGCTAGAAG
TCTTCTGTCAAAGTCTCTGCTGGAAGTCTTCCACATGCACATTTGTCTTGGTTTCACTATAGGGTTCTTTGGCGTAATCAGCATCCGGGAGGCTGACACA
TCCTGGTCGCAAGCCGGCTCTTCGTGCATAACATATCCGGCTGGTCGTCTTGGTCGGTCTAATGTATTGGGTTTTGTATACTGGAAAATTGGAAAGGTCT
TGGTGGGTACAAATC