Description :
From Genome Similarity Track
Location :
scaffold_76:117382- 149669
Transcript NameFunction/comments
g7370.t1hypothetical protein
g7371.t1 conserved hypothetical protein
g7372.t1 hypothetical protein PHYSODRAFT_538644
g7373.t1 hypothetical protein PHYSODRAFT_488092
g7374.t1 hypothetical protein
g7375.t1 phospholipase D-like protein
g7376.t1 phospholipase D-like protein
g7377.t1 hypothetical protein PHYSODRAFT_308430
g7378.t1 hypothetical protein PHYSODRAFT_255250
g7379.t1 hypothetical protein PHYSODRAFT_255250

Sequence
32287 bases(100 bases per row)
GTACTCCCCGATCGAAATTTGCTGCAGGAACGCAAAGGGATGCGAACTGTTGGCACAGGCGCCGTACAAGTCGATGAAGCGACCGTTAGCGATCACAATT
ACGCGGGTCCTGTCGCACACTGCAATAGTTTGATTGTCACCCGCTTGGAACGCTGCTCCGATGCGTGCAGGGCCATCGATGCACACGTCAACGTCCAGCA
CCTGCAGCCGATCTTCCGTCATGATGCACTTTGTTTTGACCAATTACAGAGCTGAGTTTATTTGGCGAATCAGAATAACTCGCTGGTTTTGTCGAATCAG
CGTCGGCTTATGCTGACCAGTCAGCCTACTGTACTTGACATACAAACATCAAGTCAAAAGTCAAACTGCTCGCGACCACTGCCTCACCGCGTTCACTATC
GATTTTGCTTTGTGGACGAGAAGTTGAATGAGAAGCGGTTTTGTGCATTATTATAGCGTTTACAGCGCTGGCGATGGAGTGAAGATACCTAACGTTACAT
AGTGATAGGAGCGAGGACCGTTTTGGTCTCTCCTCCTTCTGTGAGCATTACACTTTGTCATAGTTACACTGACCATCCGCCAACCCACCAATATCTGTAT
ATTCCAGTAGTGATCGAGCGCATATTGTGCTGCGAGTGGTCGATGCTGAAGAGCGACGATATTTTTCCAGCCAACCTACCCCACAGCACCAACACTGGCC
CCCACGACAGTTGTTCTGTTGAGAATACCCCAGAAGTGACTTCACTCGATCACTCGTTGTACTGGTGCGCAGTTTTCAAGCCTGGAGAGTGATGAAGCGA
AACACAGTACCAACACTGCGACCGGGGTGCAGTTGTTCTGACTGTCAACGACCGTATCTGACTCCTTCGAATCCTATGGCGTAGTGCTATAGGATGTTAG
ATCAAGTTGTGAATGGGTGTAGTGTGCAGCCTCTCCGCAGAACTGATGATTTATCAAGCCCTTGTTTTTTTTTTTTCAAGGGCAGTACCAACTATCTTTT
CCAGGAGACCGTTCTGTTGAGACCAACGTCTGATCTGCTTGAGCGCTGTCTGCATTGCCCATGTTAACAGAAATGAAACACCCCAGTATTGGAGTTTTGA
TCATATCCCAGGGCCAGCATCGATTATCATCGGGGGCCACGTGTAGGTGTGTTGAAATCCAGGGGCTCACGCGCCTCAATCAAGTGGTGTCACGGGGAAA
ATTTGATCTAATGCCCCATGCCTGAGCTAGTACTTCGACTGGAATGTGGCTGCCACGAGGTAAAAGTGCCGGATCGAACCAGCGACGCTTTCTTCATAAG
GTGACCTTGGTGAATTCTTGGCAGCAAGCTGAAAATGTTCCATCCTTCAAGGATACACGTGACTCCACTCGTCCCGGCCTCAGCGCGCACAACGCGCACT
CCTTGCAGATGCCGAGCGCACAAGTCGTAGAACTCAAGCAGCAGATATTCCGTGCTTTTCTCCTCGGGTGCTTCGGGAATATTGTTGGTAGAATGATTTG
GGTCATGTTGAATATGACTGTGCCGTGCTGTTAGCTTTGGTGTCTCGGACACTCTCGACGTTGGTGGGTTCTTCATTGCTGCTGCCGCGAAAGGTGCGAG
GGTAAATTCGTTTGAAGACCCTGTTGGCCGCAGTGTATGGTGCCCTAGCACCTGGCGAGCTGCACCAGCCATAGCATAGCTAGTATCAGCAAATTCAGCT
CGCAACGAGTCTCCTTTAGCTTTCCACTCGCCAGCAAGTCCTCCTGGGGTCTCTAGCACGTGGGTGAGTAGTTCAAGCCACTGTGGTGATAAGACACTGC
GAAGCCACTGGTTCTCCCGAAGTGCGGCCCCCAAGTTTGTAAACGCCCACGCTGAGCTCAGCTGTTGCGAGTGTCTGAGCGCGTAGGCGACACGATGAAG
CGACTTGATCAGCAAATGCTGGCTGCTCTCAGCGTTAGAGCTTTCGCTTTGAGAATTATGCAGATTGTCGTGCTGATTATTTGGCTGTGTTGATGCCGAT
TGACGTCGTTGGTTCAGCACCACCGACTTCTTTTTCTTCTGCTCACGCTCGGCCTTGACTTGTGCGATATACTCCGCGTCCTCGCGTTCATGAGCCAGGT
CCGCTTCGAGTTGATACGCGACCTGGGAGATAATTTGAGCCCACGCCTGCCGATTCAGCCGCAGGTCCATTTGAGTTCGACAGGACCAATGGGAACCAAG
ATTGAGATTCTTGGCTACCAAGAGGGCCTCAAGTGAATGGCTGCACAACCAGCGCAGCGAAAATCGCTGCAAAAGGTGGTCAAACTGCATGGACGACGGC
AAACCTAGCGACTGCATCACATGATACAAATCCATCTCTCCAGTGAACAGGATCACCAGTCGAACTACTGGCGATGACGGTCCAGGAGTTCCACTGCTTG
ATGGCCCCATGCGTAACTGGGGTTTCGTCGGTAGTGTAACAAACCAACGGTGGAAGAACGGTAGCGACTCGATATGATCGCGAAAAAAATCGCCCAAGAA
CCATGTTAAACGATCGACTAGAATTTGAGCGTCGCTGTCTACAGTAAGATAGCCACATACAAACTAATTAGATTTTTCCTGTACGGTTGCCAGTACCAGC
AAATGTACCAACCTTTCGTGCCACTCCGACAGGCGAAGTCGATGTACATGAAGCATTCTGCACCACGCTCCAGATATTTCAACTCGTGGAGTGTGGCAGC
AGCTGCACATTGCATAGTGTATCTGGTTAGGTCAGCTCCCAACTCAAGACAACAAAAATCACTTACAGTCAGCGTCCGAGTTGTAAGTGAGATGAACGGT
AGCGGTTGTAGAAAACTTGTGCCCTACGTCAACTTTCACCATATAGTCGCCTCGATCGCCGCCAGGAGTGCGAGACAGCAGACAACTCGCAGACAGCAGC
CCTGTGGCCGCTGCTTGGCGCACATGTTTAAATATCCATTGAACTCGTTGCTTGAGTCGTCTCAATGCGCAGAAGGAATGCAAACGGCACTGCAAAAAGA
ATCTGCGCCAGCGCTTCACCACACCCACGTCTCTATCAGCACAGAACCAGCTTCCAAGTAGCAGAAAACGCAATGACTAATCACGTACCTACCGTTTTCA
CAGCCGGACACCAGGAAGAGGACATCAAGCTCAGAAACCCAACCTTGCAGATTCGTGGCTGTTCCTCATTGTGCTCACTTCGAGCATGCCCTTCATTCGT
GAATCGTAGAGCCGACTTCTGACGGTATCCAAACAAACGCAAAGTACGCTTCAACTGGTGTATAAACCTCAGACAACGTGCGAGTTCGTATCTCTTGCCA
ATGATCTCCGCCGTCTCGTCGCCCGTTAGGACAAACCCACTCTCGGCCAGCAAATACTGCGCAGCTTTAGCCGTCACTGAACCCGTCGGATCATCCACAT
ACGCGTCAAAAAGCTGTTTCATCATCTCCACTCGCTCGAGCTCTTCCCACTCCAACGAAATCCCCAACGACGCCAAATCTCGTGTCAACGGCTGTTCGTC
CTCAATCTGCTCTCGGTACATGACAAACCCTTGGAACGTAAGCCTCCCTTCCTCGTCCAGCTCGCACATATCACTCATATACATTCCCCAGACCTCTGAG
CTCTCTTCAAACGCCCTCAACTCCACTGAATCGCTCGAGCACTGCAACGCCGCCATGTACTCCAGGAACTCTTCATGTGTCCACCTTTCGTCCTCGTCTG
CGTCAAAAAGGGTCCAAATCTTCCGACACTTGGCTTCTCCCAACGGCGACAGTCTCCACTCAAGTCGAACTGCATCTGGAGCGTCGAAACCAAAGCGAAA
CGCTGCAGAACTCGTCAAACTCGCCACAGTCCGTCGGAACAAGGAAGTGGTCGGGTTCCAATGGGTAGCGGGCGACTCCAATAGGTACGCGCTATTGTAT
CCATGCGTGACAGCTCCAGCCTCCCTCAGAGAGTTCTCCACCGCCCTCAAACTGGATCGGATCTCGTCTCTGCGCTCCAGAATCGCCGCCTCATTCGCGG
CCAGCGCCTCTTCCTCCATATTGATACAAAATGTAGCCATCTGTAGTTGAAGCGGTGCGATCTTTCGTTTTATTGGTAGAAAAGAGATGGATTTCCAACC
AATTAAAAGGATTTCATTTGGTGGAACAAGGGGAGAATTTGATTCACTTGGGACCTGATGGACGAGGCGAGTAAGGCGACGCTGTTCAACGCGCTGGCGT
GGGTGGACACGCTCAAGACGCGTGAAGGCGTGGATGCACAGGAGATCGACACGGCGCTCTCCCGTCTCACGTAATTTCAGCATTTTGCTTGGTCCTACAA
GCTGCAAAATCTCGATATGATGTGTTTTTCTAACGTAACAGTTTACTTCTTTTTTATCATTATCCACCACATAGTGAGGCTTTCGGCGTGGACGTGCACG
ACGCCGAGCAGCGACGACAGCTGGCGGTCGACAGCGACATCTCATTCAACGAGATTTTTGCTGCGGGGCTCAAGGCGCTGAACCTGGAGACTGGCGCGAA
GGAGGCTGTGGACGAAGATCCTGTCGTTAAAAAGCGTACGTGGATGATTTTTATAAGAGAAGGAGGAGAGCGCTGATTGGCTGCTTCTTTTCTTATTTGT
CAGACCCGGAGCTCTGGAAGAAGTGGGTGGCCAAGCTGGAAGCCAAGGGTTTCTTCAAGGACGCGGCCCCTGGCACCAGTGAACATGCTACCCGTACGGC
CAAAGCGCTGGGTAAATTTAAGGAGAAATTCGGAGATGTGAAGCCGGAGCTTTCCCAGGAGGAGAAGGAGGCCAAGGCGGAGGAGGTGAAGGCCCAGGGC
AATGCGGCTCTGAGTCGCCAGGACTACGAAGGAGCTGCCAAGTTGTATCGAGAGGCGCTGCAGCTGTCACCAGAGGGACCGTCGTCGCACATTTACCACT
CGAACTTGGCTGCGGCGTTGATGTACCTGGGCAAGTACACGGACGTGATCGACCACTGCGAGCAGTCGATTGTGCTCAAGCCGGCGTACGTCAAGGCCTA
CTCCCGGTTGGGCAGCGCGCAGCTGCAGCTGCAGGACTTTGACGGCGCTATCGACTCGTTCCGTCGTGGACTTGAGGTGGACAGCTCCAACGCTGCTTGC
CGTGACGGCCTTGCAGATGCTGAGCGCAAGCGCCGCCAAGTGCAGACGACGAGTTCTTCTTCAGCTACACCCCCTGCTGGTGGCGCTGGTGGCATGCCGG
ACCTGTCGAACCTGGCCAGCATGCTGGGCGGAGGTGGCGGTGGCCTCGGCGGCGACCTCATGAACAACCCGCAGATGATGCAGATGGCCCAAAGCATGAT
GCAGAACCCGCAGATGATGCAGATGGCGCAGAATATGATGCAGAACCCCGACATGCTCAGCGGCCTCATGGGCGGCCTTGGCGGCGGTGGTGCTGGCGGT
GCAGCTCCCTCTGGCCCTGGTGCTGGTGGCATGCCCGACATGAGCGGCCTCATGAACAGCCCTGAGCTCGTGGCGGCGCGATCCGACCCGGACCTGGCAG
ATTTCTTCCGCGACGTGGACGCCGAAGGCCCGTCGGCCGCTATGCGCCACATGTCGAACCCCAAGGTCTCGCAGCTCATGCAGAGCGTGATGGCTGGGAT
GCAAGGTTAGACAGGACAGCAAGCAATAGCGACGCAGCCGTTCTACTGCTTGCAGACGATACGAGGACTGTAAATGGCAAGTGGTGAGTGAGGCTCTAAC
TGTTTATTGTGTGCGGTGTGGTCGTCACGAACCTCAAGCAGCCTGTACGGTATGCAGCAATACGGGTTTAGTGCTTGACGAAGCTCTCGGCGTCCTGGAG
GAAGGTCAGGTACTCGCGCTGCTCCTTGAGATCAGCAAACTGCGCGATGAACTGCGCCAGCTCGTCGTCGATCTTGCGCTCGGCCAGGTAGCCGTAGAAC
TTGTCCTGCACGTCGAGCTCCAGGTCAATGAAGTTGGGCCCAAAGTACAGCGTCTCGTCCTCCGCGTCCTTGGCAAAGTCGCTCAGGTAGCGCACGCGCT
CCACCGTGAGGTTGCTGCTGGCCACGCAGTCGAACTGCAGGCCCTTGTTGTCACGGGTCACGTCGGCCGTGAAGCGGACGCCCGGGAGCTCGTCCTCCTC
CTCTTCGTCCTCGTCCTGCTCCTGCTCGTCGTCCTGCTCATCGTCCTCATCCTCGTCGTAGTCCTCGTCGTCTTCGAGCTCCACAGTGTCCTGGGCATTA
AACTTGATCCTGATGGACTCGGAATCCACCGAGCCCTCGAGCAGGACGTCCATGCAGCCAGGAGTCTCCTTGAGGGCGAACACCTCCTCCACCTTGAGAC
GCAGAGCCTCCAGATCGGGCTCCTCGAAGCAGTTGGCCTTCTCCTCGGTCACTTCGCGCTGCAATAGGAAAGAAGTAGGTAGTTTTAGGTTAGAACGCGG
TTTTTACTGGATTGCGAGCGGAATTTTACGAGTTGCATGACGTACGTTGAGAATGGACACGAGCGTCGACTTCTCGCGGGTCTGCAGGGCACGCAGCGCC
ACAGAGGGCGTGCGGCGTACGGCGGCGAATGAAGCAGCGCGAGCAACTCGGGCGAACATGATCTCGTCCTGGAAGATTTGAGAGTGCGGTGGAGCAGCTT
GGCCACATACTAGATGGCGTGTGATTGGCGGAAAAGAATGGGTTTCAGCGAATGAGGAGAGCGAAGGGCACGCTGCGGTGCCCCATTTTCAAGAAGAACT
CACACTTTGGCTTTTTCTTCGTTGCGGTTGGACTTTTTCTTCGTTGCGGTTGGACATTTTCTTCGTTGCGTGTGTGCATTTTGGTGGCGAGGATGAGAAA
ACGATTGACTCTCGAGTTCCGCGACAACCCCCCCCCCCGGGTTTTAGATGCATCTTGGGATCTTATTAGGCTGCGAGTGGACAGGAGAGCTCCACGGTCT
CACTCGTGCGAAGGATTCACCAATTGACCGGGGAATAGTACGAATCTCCCATTGTAAAGGCTGAAGAGGCTACTGCGAGAGCCCCACGCGTATGTTCTCT
AGATGGTGGGAGGGACAGTTTCCAGCAATTGGAAAAACAAACTTTTAAGAAGGAGGAACTAGGAGAGAAACAAAAAAGGCGAAGCTGAGCCACCAATTCC
ATAATTCATGTTGAGACTTGGTAGAGGTAGATACTGTCAAAGTCTTGAGCGTCGTCTACATGGACGAGTTGACTTTTGTCGACCGATTTAGCAGACAACC
CCCAACGAGAAAGTAGCGGCGCGATTGATCGGTTGATACTTCGCAGTTGGTACGACAAGTAGAACTGGCAGGACGTGCAATTGCTGCAGCGGAAGATGAG
AGCGACGGTGGCCAGCACCTTCTCGAAATCTGCAAGTTGAGGGAGTTAGATGTGGTTTTACAGTTGATTCTGTTGCGATTGTACCTTCAGACTGGTAGAA
GCAGTCGGCGGCGAGGATGACTTGGACGCTTCGGAAGATGGCGAGCACTTTGTCCGGTACGAGCATGTCGCCCCAGGTGAGTCCAATGAACTGGGCACGA
TCCTCGAGACCGTTTAGCTTGATGTTGACTTCTGCGTTGCGCTGGACGTCGACAGCGTCGGGTCGATCGGTAAGATACACCTTCGTCGCGCCACACAACC
CAGCGAGGATCGACGGGAGGCCAGTGCCGCAGCCCAATTCCAGCACAACTTTGTCGCGACACAGCGAGTCGACTTCGCGGGCGACAAATCGCGACAGCAA
AAGTGCGGACGGCCACACAAACAGCCCGTAGTGCTTGTCATTGTCTTCGTTGGCCTCGTCGAGGTCACGGATAAGCTCGACAAGCCGCACGTCGACGATG
GAAGTCTCACCAAGGCGTCGCCGCTTCAACTTCGGCTCTACAGCCGTCACCGCACCTTGAACTTTATCCAACGGCACTGCTAACGCCGCGTCATCACCAC
ACGACCCACAGACGAAGCTGAGCGTGCGTTGCGACGCAGCATCAGCGCTCAAGGCCTCCATGCTGCTGCACCAGTCACGAAAACGGGACGGAAGCGATGA
GCTACCCGTAAACTACTGTCGACGAACAGATCCACTTCAACTTGGGAAAAGGATCTTGAAGCGGATTCACCAATGCCGGCAACGCGACGGTTGGAACTGA
CGGCTTTCGACCCGCAGGAGCAGTATTGACACCAAACTCGAAGGAAAACGGACTTGGACATGCAGCAAGACGAGGTTGACCAAGCTCTCGACGCCACCAT
CTTGCTGCCTGATGAAGAAGCCTCGCTGTCGAAGCAGATCATCACGAACTACTTCACTAGCGACGGACCACGAGCAAGGAGGCTGGGTTCCAGCGACCTC
GAGCCGGAGAGAAGCATTTTGGATGAAAGCAGCGGAGACGAAGAACTTCGACATTCTGGGAAGATGCCAGCCGAAGTACTACATGAAACGGAGAGAGAGC
CATCGGAAGTATACGAAAGGGAGACCGTGAACTCTGGAGTTGACAATCGCGAGGAAAGAACGATGGGGATGCTCGAAGAAATACTGACCTGGGAAATCGC
GCTGTCAGTGGTAGTCGTGATTTTAGCCCTGGCGCACTGCGTGTGGATGTGGAACTTGGTGGAGCTCAGCACTTTGAATTTGGAGTTTGGAGACTAGAAA
GTGTGCGCAACGAATACAGTTGGAGATTTCAGCATGCTATGATGAATATGCTACTGATCTGTCTGTTGAATGTGTGCACTACCTTGCGCTGTGGAGGACT
ATAGCTGCAGACAAGCTTCGATCTGTTGCTGCATCCGTGTTACGTGTTGACAAGAGAGGTCTCCAGCACCTTCTAGGCCTGGGGTGGCACACGCTGCCTC
GTGGAGCAAGGTTAGCTGACTTGCATCGAGCGTTCTCAGCACCTCTTGAAACAGGGCGTCTTGATTAGCCACTCCGTTGGGCTCTTGCATCTCGCCGACT
GGCGATGGTTGCTGAATTTCCTCCTCCTCGTCCCAGTTGTCCCAGGATTCAAGCGCTGAATTTTGCTTTCCATTAACACCAGATACGGTGAGGGCCTGCT
GTCGCTGGCTGTAAAGACTGGCAATTGCAACCAGTAGCTTCTCCTTGCTGCGGTTGCCGCTAGTAGTGCATGACAGCCACATTTGCAGATAAATATCCAG
CAAGTTGGTGTACGTTGCGTCTTTGATTTTGGTCTGCGGAGCACCAAAGGTGTCACTGAGGCACTGAACAATTTTGTCGAACTCTTCATATAGTTGGTGA
GAGTTCGGGGAATGAAGTAGCATGCTAAGACTTTCTAAGAGGCTGGATTGAGCCTCTGACTTGTTCATCGTGATCCAGCGAAACATGTCGTTGCACAATA
GCCACGATAGAATGATGCGCTCCAAACACAGCCATCGAGAATACCACGACAGGCCAAAGTCACGTGGTTGGACATCATCTTTTGCGGTTGAATCCATAGT
TTCAGCCACGTAGTGCATCGTCGAGACAACGACCGGAAGCATAGGCACCAAGAAAATGCTGAACTGACGATCCAGTGAGCTATTGGCGCTCACGGTATTT
CCCATTTGCGTTCCTAGCTGCAGACGTTGGGGGAGATTTGCGTGCATCGCTCGTAGCGCGCCATCTAAAAGCTGAGTTAGCTGACGAGGTGGATCTGCTG
TTCCTCCGAAACAAAGGAACGCTAAAAGCCTAATCTCTACTTGCCCCACTGCTGTTTCTGTATCAAGCGGAAAGCTCTCCGGATTCATTTCCATTGCTGC
GATGCCGTCCCACACAATTGTCCAATCCTCTACTAGTTTCTGCGAAAGAGAACTCGAAGCACAGCTACCTAAGGCATCCACACTTTCTTGCAAGTACCGT
AAGTGCAGCAAAGTGAACTTCGCACACGCACAGCACCACGATGTGTCCGCAGAACCGCTCTGAAACTCAGTAGATGAGAGAAATTCCAGCTGATCGGTCC
AAACAATTAGCCTCATTAACCCAGGAAGAAGCTGCCGAGAGATTCTGCGAAGCTCAAACTGTGAGGACTCGAATGCCTCTTTCGTGTGAGCGATGCATCC
ACTCAGAATCTGCTGCCAAAATCCTTGGCTTGAAGCAGGTAGGTCGTTTTGGCCACGATGCGTGTCCACCCAATCGCTAATAACCTGGACAATTGACAGG
TTCTCTGGTTCCTCCTCTACTTCATTGTCATTTAGCACCCATGTCGCCCGCTGAGCTTGATCGTGTGCCCACTGAACTGCTTGCAAGTGGGAAAGAGACG
TTGATCGTCCTTGTCGAAGATTGGTAGGCACCGGTTTCCACCTCAACAACTCATTGGATTGACAAGTCACAAGACTTTCGCCAAGCACGTTCATAAGGAC
TTCAATGCTCAAAAGACGACCTTCTCGTTGTTGCCAACAGAAATCAATTGCATCTCTCCGTTTGTTAGACAGAGAAAGTAACATCTGCTCAATCAGCTTC
AAGGAGGCCTCGTCAAAGGCCGAATTTGCGCTTGGCTCCAATTCGTCATCCACAGACTTTCCTTGCTGGATACCGCTCAAACCAAGCTTTGCCAGCGCCA
ACACGACACTGCTGCTCTTTTGACGAACACTGGATGCGATGTGCATGACGTATTTCTCCAGCGTTGGAAATACGAACTTCCAGTGCCTTAACAAGAAGCG
TGAGGGGAGACATGGAGCCATCCGAGCTAGGACATCCAGTAAGCCTTCCGCCTCAAACGCATCCAGAAGTTCTGACTCGCTGGTGTTCGCGATACCGTCA
CTCTCATCGACCTTGTCATTGCGGTTCATGCGGTTTAACTTGCTGATCACTTCCTGGAAAATGAGTAGCCGTGTTGGGGTTTCACAAAGTGCGGCATATT
CCACCAAACATCGGGCCGCAAGCTGCCGAACAGTAAGCTGGTCGTGACGAAGACACTGATAAATGGCTGGCTTCAGCGTTTGTACTAGACATCGCGGCAG
TTGAGTGAACGTGTGGCGCTCATTCAGCCCAAGTCGATATCTCACTGCTGGCGATTGACGGACGCCCAATATGCCCTTGATATCCTCTTTAACCTGAGAG
GTCTTGGGGTTTTCGGGTTGTGGAGATGTGGAGTCCATTTTAATGGAGCGCAGAAGATCTGACAGCGCCAACAAAGCTCCTTCTCGCTCCGTCCACGCTG
TCACTTGGGTTTTGTCGGCGCTCACACTTCGGGAGCCGACAGCGACACCGAGCAAACTGTCCATAAACTGCTCGATGTGATTTAGGGATGGAAACTCAAA
CGCGATGGCTGCTGCATTCTTCGCGCAGTCCTTCCGGATTGCAGACCACAAGTCGGTCACACCAAGTAACAGCAGCCGAACTGCTTCATCAAAGAACTTG
ACATCAAATGGTGGCGATGACCCCGCACGTGCAGCCTTACTCTGCGATGCTTGCCGGAGTATTTGGAAGGCGAACGTCAGAAAGCGTTGGCGAGCCCGAG
GATCCTGAATTCGCTTCACGACTTTATTCAGACTGGAGATAGCAGCAGCATCCCACTCGTTGTCAAGCAGCAGTCTATGGTACACATCGCAGGTTAGACT
AGACGAGGCAACACGTTATGAGACCAATACATATCACAACACACCCATGCAGCACATCGACAAAGCTCTGAAACTCGGCAACGTCGCGTCCCTCCCAGTC
GACAGAGATTTGCTGATCGATCCCTAGAATCAGTTTACCTCCTGCAGAATCGGTCGTAGCTCGAAACTTTCGGACCACCAAGTAAAGTAGCAGATCTTCT
AGCAATGACTGCGAGTTGTTACGGCATTCGTCGTCGCTATCAAATTGCAAAACAGGAGACTCGCAGCTCAAAGGGTGACGTCTATCTGCAGTTTTTCACT
TGAAATCCGAGGCTGCAGCAATCGACGAAAGGCTCCGAGCTCCTCGTCGTGGCCTTCAGCTAACAGCAGACGCCGCACCGACGCCATGCAGCTTGCTCCG
CTCTTACAGACTGCGACTCCTGGAGGTGAGGGCGGTTTTGCACACGCATTGAAACTTGCACATGCATTAATATACATGGGTTTGGATAAAACCATCACCT
GCAAGTAGGCAACCGACGACGAATGACGCGGTGGCCGTTCAGAAGCGTCTCGTGATGCTGCGAGCGCACCGAGACTGGAAAGAAGGTTTGAAAGCGGGAG
TAAAGGAATTCAAAGGAGCACAACTTCAACCGTCCAAAGTCGGGTTAGGCCCAGGTATCATTGGGATGTGGCAGGGGGCCAAACTACGACCGGACATTGT
TCACGCACCCCATTTCGTCGTACTGTACCGCGCAACGGTCGCAATCACGGACTGTGGCCTATGCTGTGCCACAGCCTGTGCGTGAGCATGAGAGCAGATC
AAGGTGATAGATATCCTGTTCCGCTCGTGATCAGTGATCGCCAAGTCATAAAAAACTGCGGTATGTCGCCAGCTATTCGTGCACATTCGGAAATTCTAGC
GGAGAGCATCAAGTGTTTGGAGATAAGTGCTATCGTACATGACAACGCTAGTGATGAGTTGAGCGCATGTAGTCAACTTGCTAGCCAATTATCTGTTATG
GTTGTCAGCCTCCTTCCTACAAGAGACTGAGATTTCGAGATAGGCGCTTCCCGGTTGTACACCGTAGCGCGATGTATTTGTTAGTAACAAGTCATGTTCA
TGTACGTTGTACACACGTTGTTACCGCAGTCACGAACGCACACAAAAACCTACGCATACATGTATCGACCGTGCTAGGCAATACACTCACTGTATTGCCC
AGCACGGTGTACTTTGCACCTCACACAATCGAATTTGCCGCCACCAACGCCGTTCTATTATACATGATGCGTGATTTCTTGGTCTGCTTCACACTCGTAG
CCTCCCTCGTTTTCTCCGCGCAATCGCAGACGACTGTCATGGTGACTTCAGAATCCCAGTCCAACGCTCGCCCGGTGCTGTTGCTTACGGGAGATTCGCT
CACAGAACACGGCACGTACCCCTCGATGCTTGGCTGGGTCACGCAGTTGCAGGCCCGATACACGCGCTCGGCCGATGTTATCACCCGTGGACTCTCCGGC
TACAACACGAAATGGTTCCTGAAGTACGTGATGCCCGTCCTCGAGCAAGAGATCAGTACCAGGAGCTACACCGTTCCGTCTCTCATTACGGTTTGGCTTG
GCACCAACGATGCTGCGCTGGTAAACGGCAGCAACTCGGAGATGCACGTCCGTATCGAGGACTACAAGGAAAACTTGATCCAGATCGTCAACGGATTCCA
GAAGACAGCACCGAATGCGAAGCTATTGCTGATCACCCCACCACACATCGACGACGGTGCCAGAGCCAAGTACGCAGCCGAGCGAACTGATTCCAAGCGC
GGTCTCGTGGATCGCTCGAACGCCATGGCGGGAAATTACTCTCGCGCTTGTGTGGAAGCCGCCGAGGCTCTCAAAGTTCCTTTGCTGGACTTGAACGCAC
ATTTCAATGCCATGCCCGTGGCGACTCGAAACGCGATGCTGGAAGATGGGATCCACTTCAACGCGGAGGGCAACCAAGTGGTCGACCAGCAGTTGCAGAG
CAAGCTCCAAAGCGAGTTTCCCGAATTGATGACCTCGTTAGATACTTGGCAGGTCCCAGCGGCGAGCAAGTACGTGTCAGAGGACCCGTGGAAGCCTGAA
TAGGGGATATTGGACGAAGACTGATACTGCCTCACAGATTGACCTAGTGACGGTATCCGCCGTTGATGACTGCGCAAGTAGCGTCCTAATCACCTCAAAT
GCTTCACCTGGCGTGGTTAAGGTCGTAGTCGCTATGATGGCACGGTTGTCGCTCTTGCTAGAGACCCATAAAAATTCCCAATGGTTTGTCAAGTTCGTGA
GAAGTGCCATCACTGGTTCCTCGACGATGAAATCCAATGTAATCAATTCCGACAAAGCCTGGAACTCGGACGCTGATTTCACCTCCCTTTTCACATTCTC
ACTCCAGGCAAATGATGCAAATAATGCGGAAACTTCTGGGCTATAGCACTCAGCACGATCATATCCGTGCGACCAACAAGATCAATATCGCGACCAGTGA
CTTCAACGGAGAGGATATTTGCGCTTTCTTCCACACCAAGCACGCAAAGTTTGTTGTTCCTCAAAACATCGCCAATGTTGGCTTCCACGTACTCACGATA
ACGTCCACTTTGCTGCTCCTCGGTACGGCCCCCTATCCACTCAAACTCTTCAGCTGGAGTCGGACTTCCACCGGTGAATGGAACTGTGTCCACAGGCGCA
ACCCGAATTTTCAACTCTTTCATAGGGTTGTTTCCCTTGGTTGAACTCACTTCCGAGTGGACATATCGCGTACGCTTGGACAGCACAGAGTGTTCATACA
GTTTGTCGACCTTATCGACTAGACGATCCATCCTGGAAGTCTCGCTCGCTGAACCACCAGCCCACCGCCAGCACGTGAATTTGCCTTGGCTTTGGAGCGG
TCATGTTGTTGGCTATCAAGACATCCTGAACTGCCCACGTAGCCTTCAGCTGCTCTTCAGTGGTCACCTTTCGAACATCATCAATCCCCCCCTATCCAGT
TGGAGAGGAACAGAATCATCGCCTGGCAGCCACGCGCCACCCTCCGTCTTCGCCAGGAAGAGCTGTAGGTTACGGGCAGGACCCTTGATGTCTTCGTTCT
CCGCCTTGATTGTGTCCTTCAAGTCATCCACCGAGTCGCTTTCATCTACTCGCACCGAGAAGGCGCTTCCAGCGACACCGACGACGGCACAGAAGAGAGT
GACCATCTTTCCTTGAGTCGCGTCAGTGGAGGAGGAGGAGACCTGATTTTCTCGAAACGCCAACGCCGAGGCCAAGGTCGTGCACTACCTTGGATTGGTC
GCCAGACCAGGGGGTTCGCTGGACATCTGCAACATGTCCATAACGAACGATCACATTGGGGAGGCCATTCTGAAGACGCTTGCAGAAGGCTGCATCACTC
GCATGATCGTCGACGAGCAAAGCGCACTGCAAAACAAGAAAAACATGTCGTGGCTACGCAGATTCAAGGACGCGGGGATCCCGATCAAGACTGGGCGCGT
GGCCAGCTTCATGGTCCACAACAAATGGACGATCGTCAACGGTGAGTTTATTTTACAAGGCACGGGCAACTACAGCACGGCCGCGTTCGATGGAGTCCGC
CACGCAGAGACATTTGAGACGCGCACGGCTCAGGCGCACCTTGATTTGATCATGCGTGAGTTCGAGCTGCTCTGGGAAGAAGGACGGGTGCCCAGAAATT
CTCCATCCCAGAATCCCAGAACAGACGTTTCGTGCAGGGCACGTGTCCTACATTACGGGTGCTGGTAGGAGAGCCGGCTGACAAGGCTGCTCCCCTGGTC
CCCTGGTGCCACAACGCCACACCTGGGCTGCAAACTCTCTCCTCGTTCGTGCATGCTGTAATAATGCGCGACCGTCCGTCGATTCCAGCCCGGGTGCTCC
TCGCCTTGAAGCATCGGAATCTAGTGGTACAGTCTCAAGATTTGAACGCTGAAAACAAGAGTAAGACTTCACAAAAAGCAGCTTCGGTATGTTACAAGAT
GAATTGGTGTCTGCTCTCGTTCGCGTCTACTTCATGCCACTATCAACTTCTAATACATTTCGCTACATTTCGCAGCGTGCTTCACACTTTACAACTTGGT
CACACCTGACCGTTGGCGGACGTTGCTCGGAATAATGAGCATGGAGTGGCGAGACGTTCGAGACAGGCTGATCCTCCGGTGCGAACTGTCGTACGGCGTG
CTCAATACAATCTCCTCGCCCTGCTCCGGGTCATCGTGCATCACACACAAAATTGATCCGTTGTCGCGACTGGAAAATGGATCGAACCCAGCAGCAGAGG
TACCGAACATGGCTACGCGTGAAGGCGGAGGAGGCATCGGCAGGTTCTCAGCTGCCAACGTTTCCATAAGTCGGTCGTAGTCAACCGAGTGGTGGGGGTA
GGTAAAATCCATGTACAACATTACTGTGGGAAAAATATTGTTTCCGATCGGGCATCCGTCGCATCGAATCTACATCGTCTTCTAGGTTTTTGGCGTTTCG
CAGTTGCTAATGTCGTCTTTGTGTTGCTCGGACTTCGAACAGCACATATGTAGCGCTTGCTCGCTCGACTACTGGTACTGAAGTACATCTTTACTGTGGC
TCTCGGTCCTAGAGAGCTCTGATGTTTCTAAAGTTCTCACCAAAATCCACAACTCAGCAAGTTTCCCTCACGGAAAGCTACTTCATTTCAAGTAGTGCCT
ACAGAAGATAAAACTCTTTCTCCGTCAAACAAGTTTCCTCGTTCGATAGTCTTTTCCCCCCTCTTTTACTCGGGGTGCATTTCACGATGTAATTCTGCGG
ATTGCGGCCAATCCAAGATGAAATTCATTGCAGGAAGCCGTGCTGAATGGGCTACATAGGTGGTGTTTACACTAGATCCACTCAAATAAAGAAATCCCTC
GACCACATCGGCTAAACTATCGGGGCATCTTAGATGTTCCCTCTTGGGTTCTCTCAAACCTTGAAGCACACACCTTGTAGGCGCTCTAAAATATATCTAT
AGTATAATTACACACTCTCTCTCTCTCATCGGTCCTCGTCAGACCCATCCTCTGATGTCCACGGGTCTTGAGCCGCATAATTGCTCGCTCCAGGAAATTG
CCACAGCTCCAGCTTCGCTGCTAAGCTAGGGAACTCGTCTGCAATCTTCGTTACCACCTGCAGGTACACGAGCTGGTTGCCCGAAATGTTGAAATGCAGA
CCGTCGGACGTCAGCAGCAGCGCGTCCCGCGTCGACTCGTTCATGGCGTTGAAGTACGAGTTCAAGTCAAGCACTGGGACCCCGATACTGGCGCCCGTTT
CCACGCACGCTTGAGCGTATTTCTTGGCCATGGCGTTCGTGCGGTCGATGGTGCCGTTTTGCTCTTTGGCCATTTCGGCTCTGGCGCTGTCGTTGACATG
CGGCGGCGTGATGAGCAAAATATCCGCGGTGGGTGCCGCCCTCCAGAAGCCGCTCACGATTTTCTTCAAATTGTCCTTGTAGGCTTCAATGGGGACGTGC
GTCTCCGAGTCGTAGCCGGTTGCCAGTGCAGCGTCGTTGGCGCCGAACCAAATGGTGATGAGGGACGGAGTCGTGTACACGCGCTTCCTGATTTCGCGCT
CGATGGTCGGCGCAATGTACTTGAGGAACCATTTCGTGTTGTAGCCCGGGAGTCCTCGCGTGACGACGTCGGCAGTGCGCGAGTATTTGTCCTGCAGCAT
GGCGGCCCACCCGCTTTTCGCGACGTCGGTGCCGTGTTGGGTGAGCGAGTCACCCGTGAGCAGGACCACCGGACGGGGATCCGGTTTCGTATCTGCGAGC
GCAATGACCAGCCAAGCGACGACCGCCGCCGCAGCGAGGAAGCCGAGCAGGAGGCATTTGGCGCGCAGGGTCAGCAGCATGGTGGTGTGGCTGTCGGGCA
CGAAATGTGATTGTGGGGTGACCGTCGTCTCTGCGCGTCGGAAGATCCATGATGATGCACGAAGCAGGGCAAGTGTCCGGTCAAGTCATAATCTGCGACG
GATTTCCAGCGTATGAAGGAGAGTACGGAGTGAAATGGATAAGCGGATTCTCAATGATCCGTTAGTGTGCTTGGCAGCCCAGCCTTGGCTCATCAGGACG
TCCGTGGTGCGGGGCAACATGAATTGTACATGTAGCGGTGAAAATGGTGCTTTGGAGGCATCCTGTGGCGTGTCGCGTACAGTGTACTGTTGGGGCGTAA
ACGTTGGATGTTTCTGGTGGTCAAATCCCTGAGGCGAGGCCTGAGTTCAGTCAAGCAACGCTAACCAATGCTCGGTTCGTCGGCCCAACAAACCGCGCAT
TTGCTGCCGGCAGCTTGACTGTTTCGTTAGAGCCGCAGTAGCACTGATATATGGGCTTTCAGTGTTTTACTCCCTGAATGTCAAGGCAAGTGGTAAGGAT
GAATACAATAGTAAGGATGAAGCGACACAGTCCATTCGACTGAGCGGGGGGGGGGCAGATTTGCTCTTGCTTCTGCGAAACCTTACGATCATTTTCGTCA
CCAGCAGGCCCGCACTGCAGGCAGATCTCAAACTCCTTTTCGATATGACCGTAACCTTCCTAAATGATTTGATACCAGCTCAGTATGATATAATCCAGAA
TCTAGTACAAAAAGAGCCAGATTTTGTGTGTTAAAATTATATCTCATACAGAACCGGCACTTTAGTACGGATAAAATCTTACTTTAATCGCAAAAGTCCG
TACATTATCCTAGATATTGTTGGGATATTACGTCCTACGCATATCTAAAAAAACACAACTGAAAAGCAGCTTCACCTCTCGATCGGCACCACAATGTCAC
ACCTGGGCTGCAAGCTCTCCCCCCGCTCGTACATGCTGTAGTAATGCGCGACCGTTCGTGGGCTTCCAGCCCGGGTGCTCCTCGCAGATGGCCTTGATGT
CCTTCTTGCCGGTCTGGAGGCTGGGACTTCTCTAAAGGGAAAAAATGTGAACTCTACGGTTCACATTTTTGTGGGCCGAGCTTGTCCACGAAGTTCTTGA
ACTTTTTGGCCGGGTTCTCATCGCCCAACACGTCCGGGTCGACAAGTTGCCGCAGTCCGTCCGACACGAGGTTGAACTGCGGCTTAAATTCCACGGCGTA
CGGCTCGATGATACTTTTACCGTCGTCGTGGGCCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCGTCCAGCTCGTCGTACGTGCGCTTG
GTGGCCTCCATGAACTTCTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGAGACTGCACCAGCTCCGTGTCCACGATGTTGATGC
CGATCTCCGTGTCACTCGTCATGCTGCAGCGGTTTCAGTTGGCCGAGCCCAGGGACACGTACACGTCGTCCACGATCACCAGCTTGCTGTGGATGTACAG
CTCCTTGGACTCCTTGGTCGAGTACAGCTTGAACTTGTCCGGGTACGCTTCCTGGATGGGAGATACCATGTCGTACAGGTACTTGGCGTAACCCGTGTAC
TCGGCTTCAACAGTGCGCTGCATGATCACGATGAGGCGCTCAATGCTGGGCATCATGTCCATGATGGCCTCCAGCAGCTCCGGCACGAGAATGAAGTACT
GGTCCTGGATGAAGATGTAGTTCTGCGCGTTCCGGATCGCCTTGATGCGTGCGTGGAAGATGGACTGCTCGCCCTGCGGCGCGAAGCCGTAGTGTTCGTA
GTCTGGGCTGAAGGTGCGGCATAGCTGTACGGCGTGCGTTCCATCTTGGGGAATTTCCAAGGGAACGTCAGATTCATCGATAGGAGGCAATTTCGAGTAG
TCTGGGTTCTCGAAGTCAAGCACGTCGTCAACTAGATCCTGTGACGGCTTGGGATCGGCATTCCACCGGTCCAAAAAGTTGGCCGCAACGTCCTTGGAGG
CCGGACCCACAACGCGAGCATGAGCGTCCAACCAGCCGTTCCACAGACACTTGATGCCCGTCCGTTCACGCAGCTCGGCCTGATCGTGCTCGACTGTGTC
CCAGCGGTCGTTGGTCAGATCCACGCCGCCCACGTAGGCCACGAGGTCGTGGCCTCTACGGACAATCACCGACTTCTGGTGGTGCGACGATGTGGGGAAC
GGCAGGCGATCATCGTACACGAAGCGCGCAGGTCCGTACTGTTCGGGTGGAGGCAGCGCGTTGATGAGGTCGCGCACCTCGTGGTTCTGCGCACGCTCCG
TGAGATTGGACCACACGAGCATGCGCCAGTCAGCGCCGCGCTTCACGGCACCCTCCGCTAGGTCGCAGAGTTTGGTATCAGGCTCGAGCGGCTTGAACGG
CACGTTGCATGTGCCCCAGCCCGCGAGGTACACGAGGTCTCCGCGGCGCACCTCCATCATATCGTTGGCCACGTCATTGAAGTAACCAGCAGAGGCGACG
TAGAGCTTGACGCGGTTACCGGTCGAGTAGAGCTGAATGCCGTCACGCTGATGACCAGCACGGGACGTGAGCATTTCGCCTTCAGTGAGAAACCAGCGCG
TGGGCTCGAGGTAGGGCTGGTCGAAGGGCGCGGTGGCATCTTTCTCGGCTTTCTGCTTGAGGTGGAACGGGTCGACGATGAACTCGAAGGCGCGGCTCAA
TCCTTCGGTAAGCTCAGTGAAAGGCGAGGACGACATGGTGCTGCTGTCGCGGTTGCGTTAGAGGCGGCGGAATGCGAAATGAAGGAGACTTCCGGCCACC
CGGTCGGGCTAATGAGGATTACTACCATCGCGTCGGAGTTGATCGCCAAGGCTGCCATAATAAAAGATCATCTGCGTGAAAATCAGGTTGGCTTGAAAGT
GTTGATTGCCACAGCATGCTTGTCTCTCACCGCCAAGCACAATCCCATGATCTCTCCGATTCTCACACGTCACAATATACGAACAACCATGTTGGAACTT
CATGCATCTGCCTTCCAGGGGTCTTCTATAGCCCAGGCACTAGCTTCAGGGAGCTGCCACTCTTGCATCGCCTTGTCTAAAGCAGGAAACTGCGCTTTAA
TGGCATTTCGAATCTGCTCGTCCGCGATCTTGTGGCCATCGGCGTTTAGATGCAGACCATCCTCCAGGAGTAGCGCGTTTCGTGTCGACTCAGGCATCGA
GTTGAAGTATACATTCAAATCCAGCACTGGCACATCGAGAGCCCTACCAGCTTCAAGACACGCTCGAGAATATCTTCTTGCGTTTGCATTCGAGTGGTCC
ACAAGGCCTCTCCTCGAGTCGTTCCGCTCTGCGGCATACTTGATTCTGGCAGTATCGTCGACATGGATCGGGGTGATCAGCAGAATGCTCGCATCCGGGG
CTGTCCGTTGAAAGCTGCTCACGATCTGGAGTAAATTCTCCTTGTAGTCCTCGATTGGGACGTGCAGCTCTGGGTTGCTTCCGTCCCACAGCACGGCGTC
GTTCGATCCGAGCCAAACGGTGACGAACGATGGAGACGTGTAGGCACCACAGTTGATTTCCTCTTGGATAGCAGGCATCGCGTACTTGAGGAACCATTTG
CTGTTGTAGCCCGAGAGCCCACGTGCGATGATGTCAGCTGAGCGTCTGTATCGAAATTGCAGCAGCGTAACCCATCCACCTTTCCCCGGGTCGGTGGCTT
TCTCAGTGAGCGAGTCGCCTGTCAGCAGCAGCACTGGGCGAGGCTTGGACGGTAATTGAGAGGCTTCCGACCTCACTGTGTGTAAGAAGATTATGAAGAG
AGCGAAGAAGCAATGGAGTGCACAGACAGAGAATGCCATTGGGTTGCTGACAAAGTCGATAAATGATCGGATACTCGACAGCTCGGTGGAGGACGACGCT
TTGACCGGGTTCCATGGGTCGCGCGAGGGCGCTTGGTATCTTGGATCTTGTCGAAGCAGATTGCTTGTTGGCATGGGTCTCTCTCTTCCGGACACGGTCA
GAGTTGCACATATGCAAGTCGCAGCGTACTGCAAACCAAAGCGTTTGCAAGAGTTCGCTGTGGAGTTGTTTCGCTCCAGACACGATTTCGTATTGGCGCG
TATAGGTATTGCGTGATGCTGGAGCGATTTTTGCAATGCTGTTGTTTGCAGATCCTCAGAAAGGATACAACATCGCTAGTGCTCAGCATCGAAAGCAGCG
ACATAAACCGACATCCGTATTCACGTGACGAAGTTGCTGCACCGCCCTAACGAAAGAGCTGGTACGCTTCACCGTGCACGTATATGCTTGGTGTCCGTGT
ACCTGCGCGGCTGGTATGGGCGAATACAGTCAGCGCGGGCTTGTTGAAATTAACAAATGCCCGATCCGCCAGCAAACGCTGATGCGGTGACTCTCACAAT
GACCAAACCAGGATCTGTGCCGTTGGTCCGGCTCGGCTCCCACTTTTTCGTTGGTTTCGACGCTTACTCTGGTATTTGCTCTGCATCGCTCAGGGTCTGA
GTGTTAACCGTAAAAGAAGCATGCGTCTGCGACTCCAAGTATTGGCGGCCATCGCCACTCTGTTCGTGAGTGCCCACGCCGCGAGCGACTCGGTTGCGGA
GAAAACCTTCACAGTGGTTTCCCCCGACTCTAATGACACGCTAGAAGGCTTGTACGTCCAATCTGAAGGCCGCAAGTTCCTCATTCTCTACGACGACTCG
AACAAGACCGGGAGCGAAGAATCAGCGGAGCATTCAATCGTTGACGACGGCTCTTCGTACGAGGGTGAGACTTCGTCTGATGGCTCTGCCGACCAAGAAG
AACGGGCGGGGGCAATTCGTGTAGGCACCGTCACGAAGAAGGTGAAGAAAGTGTTCCCGAAAAAGTACAACACTCTCTGGAACAAGGCCCTGTACTACTT
GTTCCAAAAGCTCACTCCGAAGAACCGCAGGATTCCACCTTCGTAACCCTCACGTGAACTGGAAGGTAGACTAGACCTGTAAGCGAAGCTAATTCACGTA
TTGAATGCTTGGATCTTTCTCTAGTCCTTACAACAAATCACGGGGGTGACTCAACTTTTGTTTCACGAAACATGGAGACGAATGACAACTGCATATAACA
CGCCGCCGAAGGATGATTGTTGGTCCAGGGATGACGCCTGGGTGGTCTTCTCTGGCTAGGTTACGCAGGTTAGGCTTCGATACGCCCACTGCGCAGGGAA
CAGTATGGGTATCACAGCTAACGAGGTACTATTTGGCATCACCCCTCAACCGGCTCCGAGCTGTCGAAGACAGCCACGAAAACCTGGCATCGAGCCAACT
GCGTAGGCCACAACCACATGCTCGTCGGGGACTTGTGACTCAAATGGGCCGACGAGCATGCTGCCTCCGTCGTGTACAATCACCGAACACGAACAACGAA
CTAGTGGGGGAGTGCTGGCATCGTCGCCTTACTCCGAAGAATCATAGATCAACGCCTCTGCGTACGCAAAGCTAACCTCGCTTACAAGCCTGAAGAGACT
GGTGCTATTGAGTAGTATGATATCTCAGCCTGTAAGTTGTGCAACCGGTGGATCAATCGCCTGCCTGCGTAGTGTGGCTGGAGGATAGGAATCAAACCCA
GCGACTGCTGAGGCGTCAAATCAACACAAGTACGCAGATTGACAAGGCTGCACAAGGAAACACTGGCCTTGAATCGGTCATCGACGCCCTTCTGGTTCGG
CGACGGTGATTTACGCGCATAGACCGGTGGAGCTCCGTGCCAAGAGCGTGCTTGCCCGCGTCCAGGTCGGTATAGCGTGCGGAAATCCAGCAGCGTATGA
TATCCCAACTCGATGACGGCCGCTTGGCGATTGCCCGCGGAATAGCCCCCCGCCATCCGCCAGCGAGTCGTCTCAAAACAATATGGTGGTCATTTCTGCC
GCCGCCTCATAACTGAACCCACATCTCGTCGCCTGCTCCCATTGGCCCATATCCAACATGATTTCCACACGCAAGAGATCTCCCTTCATTCCTGCTTCTG
CCGTCTCGAGCTCAAGTGTCCTGCTTCTCCTCCTCACTCAGCCATGGACGGACTCAGCCGCGCGTTCCACTTCATCGTGGACCCGTTCCAGAAGGAGCAC
AAGCCCGAGAAGGCGGCCACCGCGCCCTTCGACCAGCCCTTCCTCGAGCCCTCGCGCTGGTTCCTGACCCGGGAGGAGCTGAGCACGTCGCGCGACGGCT
ACGAGCGCAGCGGCATGCACGTGTACTCCAAGGGCAACCGCGTCAAGCTGTACGCCGCGTCCGCCGGCTACTTCAATGACGTGGCCGACGACATGCTGGA
CGTGCGCCGCGGCGACCTCGTGTACCTCACGGGCTGGGGCACATGCAACGTGCCGTTCAAGCCCCACGAGCCCGACACGAAGCTCTGCGACCTGGCGGAG
GCCGCCGTGAAGCGCGGCGCCGACTGGCGCATGCTCGTGTGGTCCAACGTCACGGAGCGTGCGCAGAACCACGAGGTGCGCGACCTCATCAACGCGCTGC
CGCCGCCGGAACAGTACGGACCTGCGCGCTTCGTGTACGACGACCGCCTGCCGCATGCCACATCGTCGCACCACCAGAAGTCGGTGATCGTGCGCAAGGG
CCGCGACCTCGTGGCCTACGTGGGCGGCGTGGATCTGACCAACGACCGCTGGGACACGCTCGAGCACGACCAGGCCGAGCTGCGTGAACGCACGGGCATC
AAGTGTCTGTGGAACGGCTGGCTGGACGCCCACGCAAAGATCGAGGGCCCTGCTACCAAGGACGTGGCCTGCAACTTCCTGGACCGATGGAACTCGGACG
ACAAGCCGTCGCAGGACCTCATGGACGACCTGCTTGACTTTGAGAACCCAGACTACTCGAAACTCCCGCAGATCGACGACTGTGACACAGCCCTCGACAT
CCCCGAGGACGGCACTCACGCCGTGCAGCTGTGCCGCACCTTCAGCCCGGATTACGACCACTACGGCTTCGCGCCGCAGGGCGAGCAGTCCATCTTCCAC
GCACGCATCAAGGCGATCCGGAACGCGCAGAACTACATCTTCATCCAGGACCAGTACTTCATTCTCGTGCCGGAGCTGCTGGAGGCCATCATGGACATGA
TGCCCAGCATCGAGCGCCTCATTGTCATTGTGCAGCGCACGGTGGAGGCCGGGTACACTGGTTACGCCAAGTACCTGTACGACATGGTATCTCCCATCCA
GAAGGCGTACCCGGACAAGTTCAAGCTGTACTCGACCAAGGAGTCCAAGGAGCTGTACATCCACAGCAAGCTGGTGATCGTGGACGACGTGTACGTGTCC
CTGGGCTCGGCCAACTGGAACCGCCGCAGCATGACGAGCGACACGGAGATCGGCATCAACATCGTGGACACGGAGCTGGTGCAGTCTCCCGACAACATCA
CGGTGAACAAGCTGGCGCGCAACTTCCGTATCCAGAAGTTCATGGAGGCCACCAAGCGCACGTACGACGAGCTGGACGCCATGACGTTCCTGGAGGCGTG
CGACGCGCTCGAGACGGCGGCGCACGACGATGGCTCCAGCCTTATCGAGCCGTACGCCGTGTCGGACAGCGCGGCCTTTGACTTTGTGCCGGACGCTCTG
CGCCAGATCGTGGACCCGGACGTCGAGGGCGACGACTGAGCGCGCCCCAGACTGTGACGTGGTGGATGATGTGTCTGTATAGCTTTGGCTTTTAGTGCTT
CCTCTCTCTTGTGTTGAGAGGATAGCCCAATCGTGTTCATCGGGTGCGATTGAGAGTAAAAAAGAATGAAAACACCGTTTGGATATGCACGTTGAAGGTG
TTGAAGTGACGTTTGTGCGTGGAATCGTATGTGAAGACTTGTCAGGGATTTGCTTACTGCAGGACGACTACCAGAAGCGTTTGCTTTGTATCTTCCTTCT
GGTGCGTCCTGGTCCGCGTGGAGATCGGAGCGCCAGCCTTCGAGTGCTTTTCCGGGGACCAACGGCCGATGAGAGCTGCTTTGGACTCCCCACTTCGCAC
CCTCCCCGGCGTGGCGCTAGCACCCACTTCTGCGCTCAGTCGCCCACAACGGCAACAAGGGCCAGTTCTTTGGCATCGGAGTTTATGGTGGAGCCGCGAA
GCTGTGGCGAGGGAGGCCGAGCCTCCGTTCGAATGAACCAGCTCCGTGCTAAGTGGTTGCTGACCATCTCGTCATGCGGCTTTCGACATCTTCGTCCGGG
ACGTCACGGTAATCACCAAACTGCTGCTAAACTTCGCAGTGTAAACACCGCGCTGAGCTATAGTTGGTGTTTCTCGGTGGCTTCTTCATCTCGCCCTAGT
TTTTCTGGCCATTTCGTGTGATCTGGATGGAGGGCCTACGTGGGGTGACGTCAAAGCGGGGGATCAGAAATTCACGCGCCGAATCGCGGAGCCACCGACG
ATGGGTCCATTTCACCCGGGATTTACGCTCTACTGAATTGATTTCAGCGGAGTTCAGTTTAGCTCTGGAAGCTCCGATCTTATCTATAGCGTAATACTTG
GTCGCTGTCCTCCCTTAGACTTTACCCTTCCGGCAAGAGCTCGTCAAGGGTTCTCGAACTGTTGGTAAGACTTGACGCTAGTTGAATCCGGCCACTTCAA
CCAGTGAACGAGGTGGCGGAGTCATTTCTACCGTTTCGCATTCTTGCGTCTCCGCTCAATCGCTAAGCGCTCTGCAGGACTCTTCCGGCATGAGCTCAGT
GATGACTCGGTCGCCTGTCCTTAGGGGCCTAGCACTGAACTAATTGCAGGGAAACGCGAGGGCTTTCACCGCTCGTCTTCCCGTTGAAACGCTGGGGAGG
TTGGTCAATCCTCGCAGCTTGGTTTCAAGGTCGGCTTGGTTGGAGCGCTGCTGTGGTAATTTAACTGCAGACCCATTCTCTTTCGCATGCGTTACATGAC
GCACTGGTCTTTCGGTTCCCGTTGTGAGCAGCACCGGCATGCATGAGGCAGGGGGTGGAAGATCACCGGCTGCTGACCTCATCCCAGCTTCCCGGGCTTG
CAGCGTCGACTTTCTTCGTTTCTTTCTCGCTCACTTTCAAGTTGGCGTCGTTTCGAGTACCCCCCAAAAAATAACCTGCCCCACCTCGACACTACTGCTG
GGCACCATGATTGACAGCACCCCCAAGGAGCTCGAAGCCGGCAACTATGACAACCAAACGTCACCGACTTTCAAAGGAGACCGCAAGTCCATCGTCGGCG
CTTCGATCCCTCAGCTGCTCCTGATCTCCATGCCTCGCATGGCTGTCCGGATGGCGTGGTCAGCTCAGTGGGCCGCACTTGGACCTTACCTTGGTACCAT
GATGCCCAAGTACGCCGTGCAACTCGCCCAGATCATCGGCCCTGTTACCGGCATCCTCGTGGCCCCTGTCGTTGGTGCTTTCAGCGATCGCAGCACGAAT
AAATGGGGTCGACGTCGACCGTTCCTACTGTACGGTGCCGTCACCAGCGCCATTTGCTGGACTGCCATGGGCTACACCCGTCAGATCGGAGACGTGTTCG
GCGACACCGGTAGCGGCAAGAAAGGCGAAGAGACCAACCGATTCTGGACCATCTTCTTTACCATTTTCTTCTACGCGTGGATGGACATCACGGTGAACGT
TGTGCAGACGCCACTGAACCTCATGATCGCCGACTTCGCCGGTGAACGGCAGACCCTTGGTGCTGCTCTTGGCCAGGGATGGTCCGCGCTGGGGTCTGTC
ATGGTTTCCGGGTATATCTACCTGTTTGGAGCGGCTCACCTGTCGTTGCGCTGGTTTCTCTTTATGCTCTCGGCCGTGATGGTCTTCACCGTTTCAGTCG
CATGCTTCTTCAGCCAGGAGAGGCCACGAGAGAAACTCGATCAAGTGACCGAGTCCGCTTGGCTGAGCGTCAAGGGTGCCTTCGAATCCATCTACCACGG
CTTCAAGAGTCTACCACTCGAGCTGCTCAAGTACTGCGTCGTGGTATTCTGTGTCATGTACGGCTTCTCCGCCTACAACGGCAACAAAGGCCAGTATTTC
GGCATCGAGGTCTACGGTGGAAGCCCGAAAGGCGCCAACATTTGTGCGCCTGATTGCTCTGATGCCCAAGACGCGTACAACCGTGGGGTTCGTGTTGCTG
GGGGATACGCAGACCTATGGTTTAGTCTAGTAGGCTACGCCTACTCGTGGGTGTTGCCGTGGCTTGTGAAGCGATTCGGCGCCAAGTGGGTGCTCTCAGT
CGCGCTGATCCCTCAGTCCTTGCTCATGGCTATGGCTTTCACCACCACAGTATCAGTCGACGTCACGATCGTTATCCTCACCACAGTCACGCTGACCACG
GTATTCGCGCTCAACGTGCCCGTGATCATTCACGTACTAGGGCACGAGGCTGAGATCGGTGTTTATGTTGGAGTGCTCAACGCAGCCAATTGTTTTGGAC
AACTTGTTAACTTCTCCATCGGTGCTGCAGTAGTTGGTACGCCTATGGGGTACAAGCTGCCGGTCTTCCTTGGTGGGGCCACGAGCTTCCTCGGTATGCT
CTTCACTATTTTCCTGCTCAAGATCAAAATGTTTTCCTTGTAAATTGCTGCTGCAGGTCATGGTTTGAAGACAAAACAAATACTTCACGTAGCAAACGTA
AAACAATAGCCGCCTTGCATTCTTCTGTGTGAAAATTAATGAGCACCTCGAACTACGGTAGGTAAGCTTAGAAAAGGAATGAAGAACTAAATACTACTTC
CAAGTACGTCTCGAGCGCTATCGTGGCAGTGTGCCACCGCGGGTTTACACTAGGCAATACTGTACAAGTGCAAAAGCTCAGTTTTCAACTGTACTCTAAA
GAGTACCACGTCCGTGTGAAAGGGAAATATGTTGCTATTTTATAAGGCGTCGACTGCGACGCTCACTGCACGCTGAACAATATCTGAAAACGAAATGGAC
TAGATGGCGTGGAAGGGTGCTACCGCTTCCGTCTGGTGGTCACAGCTTACATGGAGTACATCTTCATCTTGAAGAAGAGCAGGGCCGTAATGAAGCCGAG
TGCGCTCATGACACCGCCAAGGAAGACGGGCAGCTTGTAGCCGAGAGAAGTTTCGACCAGCCCGGATCCGATAGCGAAGTTCAGCAACTGTCCGAAGCAG
TTCGCCGAGTTGAGAGCTCCAACGTAGATCCCGATCTCCTCGTCTTCGCCGAAGACGTGGATGATCACCGGCACAATGAGCGCGAACCACACTGCCTGCG
TGATGCTGGTGATCGCCACGACGAAGACGTTGAAAGTCACGCTGCTCGTCCAGGCCATGATCATCAGGAAACTCTGCGGGATGGTCGAGATCGTCAACAC
CCACTTCACGCCAAACTTGTGCACCAGGAACGGAATCGTCCACGAGTAGATGTAGCCGACGATGTTGAACAGCAAATCAGCGCGGCCACCGGCGATGCTG
ACGCCGTGGTTGTAAGCGTCCTGCTCCGGGGTGCACGGGTCACAGGTGTCGGCGTTCTCGGCCGAGCCGTTGTACACCTCAAAGCCGAAGAACTGGCCCT
TGTTGCCATTGTACGCCGTGTAGCCGTACTGGACGAAGAAGAAGCAGACGCCGTAAATGGCAAGCACACCGGGGAGCGTGCGAACGCCATGGTACACGGA
AGCGAAGGCGTGGGCTATGCGCTTCCAGGTCGACACGGCGTCGACCTTGCTGGGGTCCAGAGGAGTCTCCTTGCCGAAAATCACAGCAACACTAATGCAG
ATGAGCATCGTACCCGACAGCATCCACATGAACTCGTGGAGAGTCTTGTGAGCCGCGCCGAAGAACTCAATGTAGCCGGCGACAAGAATCGAGCCCAGAG
TCGACCAGGCCTGGCCCAGAGCAGCACCGGTGGTTTGGCGATCACCGGCAAAGTCAGCAACGAGCAGCATAGCCGGCGTTTGTACGACGTTGACGGTGAT
GTCCATCCAGAGGTAGAAGAACACGGTGAGGATCGACGTCCAAGAGCGGTCGGTCTTCTCGCCGTCTGCGCCGTCGCCGTGGTCACCAAGAGCTTCACCC
ATGTCGCGAGTGTAGCTCATGGCAATCCAGCAGATAATGCTGAGGACGCCAGCAACAACCAGGAAAGGTCTGCGACGACCGAACTTCGAAGTGCTGCGGT
CACTGAGAACGCCGATGCTGGGGCCGACCAGCACACCGACGATGGGGCCGATGAACTGCGTGATCTGCACAGCAAAGTTGGGCAGCATCGTCGACAGGTA
CGGGCCCAGAGCAGCCCACTGAGCCGACCACGCCATGTTGATGGCCATTCGCGGCATTGAGACCGCGAGCAGCAACCAGATTGGCGGGTGAGAGAGCGGA
GTCTGCTCACCGCCGTCTTTGCCAGGCTTGGGAGAGCCTTGAAGTTCGTAGCCTTTCTCGACGTCCGCCATCTTGGAGTGGAGCTGGAACCTTGGAGTGG
TGTGGGCTCAAGAGCGCAAGTTGTAGAATGAGAAAGACCGAGAAGACCGTGCGGTGGTGCTTTGAGTGGATAAACACACCCTTGACGTTGCTGGTTATCT
CCACCAGCCCGTTCGGTAACCATCCGCTGCAGGCGAAAAAACAGCCATCCCGAGTCCCAGCCGCACGAGCAGCGACCCACAAAGTGCAAAGCTTCTGCTA
TTGTGCTTGGGTAGATGGGGAGCGGCTGGTGACTTTGTGACTTTTACACTGCAGAAGATCACCACTCAGTTGATCTGCTTCCCAAGACAAACGACTTGCA
AGAAGCTTCAGGCGGCGTGTTTGGTGGGGCGTTTACCAGAATTCAAAGCACCAGAATGTTTCTATTAGACATGGTGACCAAGGCTCGTTTTACTGCACCT
TGAACCGCGGCTTCGTTTCGTTGACAAAGCGTCCTTGAACTTGTATTTGCTGAAAGGAACTCCCAGCTGATTTGTCTATTTGCGCCTCCTCTGCCAACAG
TGCGCGGTGCTGTGCCAGCACCGCGGTCAAAAGCTGGCACAGATTGGGTCGCTTGTGGTAAAGTTAGTATGCGTCGCACCAAGATCCTAGTGGTAATGAG
GGCGTCAGTTAGTATTAATATGGGCCGCATCAAGATCCTAGGTTGAGAGGTTGCACAGACCGCGAGTGCATGTATGTATAATGCATGCATTTCGCATGAA
TGCAAGTTTTGCTAACTTAGTTGATCGATGAAGGTGTCGCCATTTACTTGCCAAACAAACGATGCTCACGTGTGTCATCTGATTCGTCCTGTTGCTGCAG
ATTAAAAATCGTGGTGCCACATTGAAGTGAGACCCTGGGCTATGCTCGTTAGTCCGCAGCTGAATTGTCGATTCCAGCGTTGTGGGCGAGCAGAAACTGG
ATTCACGCGTGCTCTCGCCCTCTTGAGCAAGCAACTTCAAGCTCATGTTCCCGCCAGCTCTTTAGCTTAAGAACACCCGACAATAAGAACGGTGCAAACT
GAACTACAGTTGTAATGCTGGGCGATTATGCCATGCTCCAGTTCTTTCGCGGTGCTGGAGCTGGTCGAAAACTTCAACGGCAATACAGCCTACCGAAACC
ACGCATCATTGATGTGGGTAGTCGATTAAAGCATCACCCGCAAGTTTACTCCGTCGTCTGGTTATCTACACTTACTGCCCCTTCAATTCGGCTCGCATAC
ACGTGTGCATGTATGCGCTCCTCTGCATCAATATCATGGTTTCGATACGCATCCACTTATACAGTCCACTACTACATGCTGTACATTTTCATCTTGTAGA
AAATCAAAATGGTCAGGAAGCCCAGGAAGCTGGCGATACCTCCGACGAACACCGGCAGCTTGTATCCGAGGGACGTTTGCACTAGCCCCGTGCCAATGGC
AAAGTTGAGCAATTGGCCAAAGCAGTTTGCAGAGTTTAGAGCCCCAACGAACACGCCTATCTCTTCGTCCTCCCCAAAGACATGGATAATCACTGGAACG
ACGAGCGCGAACCACACGGCGTGCGTGATGCCGGTCGTGGCAACGACAAAGACGTCGAACCCAGGGCTGCTGACCCACGCCATGGCCGAGTAAAGGATTT
GAGGCACCGTTGAAATGGTGAGGACCCACTTCACGCCAATCTTGTGCACCAGGAACGGCATGGCCCAAGCGCACACGTACCCCACGACGTTGTAAAGGAG
GTCTGCTCGGCCGCCAGCAACGCTAACGCCGTGGTTGTAAGCATCCTGTTCAGCACTGCATGGGTCACAACTGTCTGCGTTTTCAGACTCTCCGCCGTAT
ACCTCAAGCCCGAAGAATTGGCCCTTGTTGCCGTTGTACGACGTGTAGCCATACTGCGTGAAGAAGAAGGCGACCCAGTACACTGCAAGGACACCAGGAA
GGGTGCGGATCCCGTGATACACCGCAGCGAATGCGTGCTTCACCCGTGAACACGACGACGCTGCTTCCACATCATTCGGAGATAGCGGTGTTTCCTTCGC
GAATACCACAGCGACACTGACGCAGATGAACATGGTCACGGACAGCATTCCCATGAACCAGTGTAGCGTCTTGTAAGCAGCCCCGAAAAACTCAATGTAG
CCTGCAATCAAAATCGCACCCAACGTCGCCCATGCCTGACCAAGAGCTGCGCCCGTAGTCTGGCGGTCTCCTGCAAAATCAGCGACCAGAAGCATGGCCG
GGGTTTGAACGATGTTCACGGTGATGTCCATCCAGAGGTAGAAAAATACAGTTAGGATTGACGTCCACGTGCGATCGGTCTCGTCGCCGTCAGTGCCGTC
GCCGTGGTCACCCAAGGCTTCGCCCATTTCACGCGTGTATCCCATGGCAATCCAGCAAACGATACTGAGTACTCCAGCCACGATCAGGAACGGTCGACGT
CGACCCATTTTCATGGTACTGCGGTCACTGAAGACGCCCACACTTGGGGCCACGAAGACACCAGCGATAGGACCGATGAACTGAGTA