Description :
From Genome Similarity Track
Location :
contig_59:117378- 122470
Transcript NameFunction/comments
g10592.t1RAW31159.1 hypothetical protein PC110_g12501 [Phytophthora cactorum

Sequence
5092 bases(100 bases per row)
TGCAGTTTGCACCAAAGTTTCGACAGCAGTACAGAGTCAACATGAAGGTGATCCGGACGGACGGCGGTGGCGAGTTCCAAGGCCGCGAATTCATCGCATT
TCTAAAATGCCACGGAATTCGGTAGCAGGTGATGCGCCCAGACACTTCAGCATCCAATAACAAGGTGGGACGGATGCACAGGACGCTCATGAATGCTGGT
CGTGCTATGTTGTGAGCTTCCAAACTGCCGGAGCGATACTAGGACGATACAGCAAAATATGCCTCCATATCTGGAAACACATTCTAGCGAGAGGGAATGT
CGATTACAAGACGCCACTGCATGCCCTCACGGGTAAGCCGCCGCGGGTGGGGTGCATTCTGAAATTTGGTTTGCGATGCACGATGCATGTAGCTCACAAG
ACTGGAGTCTCAGTGAAGAAACGAGCGGAGAAAGGAGCCATCATCGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTGCAC
GTTTTTCGATGATCTCGGCGAATATCCCTCGCAATAAATTAAGCTCCCCTCGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAACAAA
AGCACAGTTAGCTAGCATATAGCAGTGAACACACAATTCGATAAACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCGAAG
TAGAGCACAGATGCGTGTGGGAAGCCGACAGTGGCTCCTGCAAGTTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGGCGA
GGGCTCGTACCACTGGTATAGCGACCGCTTCGTTAAACACCAGTTTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGTTGG
TAGCAGGGTTAGAGTTTCTCCATATGCACAGCTTCCCGCTGACCCTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACACTC
TCAGTTTGGACTGCAACGTATTCTTCATTGCGCTCTCAAAGGGCTTGAAGACGGCAACATCAAGTGGTTGATACACGTGCGTCGCATTATCGGCAGTATT
ACCTCTAGTATCTTCATGTTGAGTGCTGCTCCATCAGATTTTACCCAGCACTAAGGGATCGATTTTGGTGAAACTTATTCTCCAGTACTCAAGATCACCA
ACTTGCGTCTGCTAGTTGCGCTGGCAGCAGCTTGGAGACATCGTTTGCGACAAGGCCACGTGCCAAACATATATGTCAAGGCCACATTGTATTGTCCGAC
GTTGATGAAGGCCCCTGCGGTACGTCGGAGGGCAATCACACTGCATGACTGCTGCGGAAGTCACTTTATGGTTGAAATAGAGTCATCTTCGATGAAACAA
AACGGTCAACGCGTTTTTGCTGCCTTTGGGAACTGTAAGAATCCGCTCCCTCCTGGATTCTTTGCGCATCCCTAAAGTACCTCGCACTGGCCCTTAATCC
TGAATGATTGTGGTTGTACCGCCAAAGTGGTACATCACGATCGTAATTGTGATCGTGGTGGCGATTGGGATCCGGCGTATCGAAATCATTGTACCGTATA
TCGATCTGATCGTGGTCGTTTGGATCGGCTCATCAGAATGATTGCGTATATCAGAATGATTACGCTTGCGACACGACTTGAGACGTGACTTGGGACACCA
CGTGTCTCTCATAAATCCTTCTACGCACTTGCCACACAAGTGGCGTGATATTCTCCTATTTGTGGATCGTTTAGCAGATTTAAGGGTTTCTCGATGGCAC
GTGTTTTTTTTAACATTGTGGTTGGATGGTAGATAGACACTTTGACCCTACTCGTCCAATATCAATGGAAAGAAGGCAAATGCCATACATTTTTGAGCAC
ATGCATCGAAAAGAAAGACTTGAAGAGAAGCTCGGCTTTTCGGGGCGACGCACTTCATCAGCAGGCTTTCATCAATTTACAGAGCAACGAAAGCAACAGA
CGCTGACGAGTTGCGATTTTCTGGATCGACGAGATCGTGGCTTCACCAGTTGTTGCTCTTCATGACGGTGATAATAAAAAGATAATAGTTTGGTAAATAC
GGCGTGCGGTCGAAAGGTGCATGTCATCAAATGCATCGTCCATTAACTAAATACCCCTGTGACAGGGCTTCAATTTAGACGCTACTGTTGATGTTCAATA
TCATCAAGGTGAGCCATGCCTGGAAACGGGTCATATCGCTTAACGGAGGCGGACGGGTGTCTGCCAAGATTGTTTCAATGGTACGCTTACGTGACTCTAG
ATGGAGGCGTTGACCGTTCAATCGCCCCCGAGCGCCTTCCAGGTTTCACCTAGCTCCCTGTTGTCTTATGTGGACGCATCAACGGCTTCACGAGCCACGG
ATGTCGAGCGTAACGTGAATGGCTTGACAGCTGCCGCTCAGCTGGCAAATCAGCAGACTGGAGAGTTATCTTATATCGCATGATTCCAAGTAGAATGGTT
TAAGCCACGCATTTTGTGGTTTGCCCACATTCGTCACACGACAGGGCCAGTCTGAAACGTTGCTGCCCATATATCTTGCAGCTGAGCTACGACGCCTCGA
AGCGAGCTCTCAGCTGCTGCACCTGAGCGATCAGTGAAAGCCGGGCGAATGCACGCATCAAGAAATTCTTCCAAATCTTGTGCCTTACTAATGACCATTT
CATATTCGTATATCATGAGACAAATAGCTTCTCTGCGAGTTGAAATAACTCACCGCCTCAAGCTTGCTCAGTCTTAGCGCTGTCGAACAAGTGCTGGTTC
CCTTTAAACTGCACCTCGCGGTCTCTGCAACAATCCAGGTTCCTTCCTGCCTCACAAATTGACTTTTAACGCGGGAGCTGAATTTGATCCATAGCTTGTG
CATAACGTTTTGCAATCTCGCGCAATTTACAACGAAGTCATCTAACGTCTTGCCTAACATCTCGCGCTGCCCGACCGTGCTGTTCACAGTTGATCGAACT
GCCAGCTGTAGCCGATGTTGCTCCCCAGTTGATGGTGCAACTGGCGATGCGGGAGATACAGGTCGGCCAGCGTTCGTTGGGGCCGCTGGTGGTGCATCTG
GAGATGCGAGAGATACACGTGTAGGTCGTCCAGAGCGCGTTGGGAGAGTGGTGCCACCATATCCGCAACCAATGCATCGGATGTACGGTTGCACGTGATC
ATCACCAACAAACGACGCTTGAGGAGGTGCTCTCTGGTGCCGCGCTTGAATCCACACCGCTGCTAGCGAGTCACGCCTGATTAGATTTGCTTCATTCTGC
GTGCTTAGGGTAGCTAGGGCTGCGCTATGTTCTTCACCGTCGACCATTGCGATCTATCACGAACCTTACTCACGGAATCGCTTCGATTATGCATATTTTA
CGATATTCCAGATGGAGGTCGATTGACTGTGTAGCGGGGCTACACATTCGTTTCACCTCCCACCTTAGTGCAAATACGCACTAATGGCTACATTCAGGTT
GACCCCTCCACCGAGTGGTTCGCATTCATACCAAAGAGGTATTACTGGTAGAAAGCAGCATGTTTCTATCAATAAGAGTCATTCATTAGATAGGATTGCA
ACACCCTTAGCAGCGCGCGAGGCAAGTTCATCATTATCGTTAAAAGTAACATCAATACCAACGTCGCAATCGGCTGCTTTAAGGACAGCCACCCCCGTGT
ACCAACACTCGAGCAGTAGGTCAGCCTCTCGCTTATAGTTCGCTGGTGTTCGGCAAGCGCTCGTATCCGAGCCACAAAGGACGTAAATCAGTATCGCAAA
GAAATTGAAACAGCAGCGGGTGCTCACGAAAAGTGACATCCAACAACTTGAGTGTTCCATTATCATCCGACCTGTGCAAATTTGCCGGTGACATCTGTAC
TCTGATGTCGACATATTTGATGCTCTGTGAGGCAGAAACGCCCATCTGAGTGGGCGAAAACGATGTTTTTTCGTTGAGATGGACTTCTACGAAAGAGCAA
ATCTATGCCAGTGTTCGCATACCTTGTGGACACTCCGGTTTAGTGGCAGCACAAGTCTATTGTAGAGGTCTAAATTAGAGGGCAAAATAAACGCAAAGCA
ATACGATGAAAAATGTATTATGCACGAACTAAGCCAATCAGAATCGAGCCTGGGATGTATATTTCCGTAAAAAAAATATGATGATCCAAAATTCGCTCTA
TAGCTTTCTTGCAAGAAAACTCAAGACAAGAAGAGGTGTAAGCGCTATTTTGGCAATTATCTTTTTCCTCTAAGACGTCCTAACAAAGTGTCCGTCTGTC
GGGGTTGTGCTGTGGCATTGCCTCTTGCGAGGCGACCAACAGCTTTGTCTGGGTCGTGCTTGATGTGCTGTCGCTTGGGTAATGGTATACTGTTGAGGTC
TTTTTTGACTTGGCCAGGAATTTCGCGCTGAAGAAGTTAACTACGAAACGTTTTTGAGAAGTTCAACCATCAAATCTTGGATTCATACGTGTACAATTGT
CACTGACAATCTGTCAGTCAGACTTCTTCCTTGCGCGACGGCGCTGCCTCGCCCTCTTCCTCGTAGTCGGCCATGTCTCGATGCAACGGGACCTGCAGCG
ACAAGAACAGGAAGGCGAGTACTTGCAGACTCATCGCGATCAGAGCGAGAGCTGCCACGTCGTAGTACCGGTTGGCGTAGTCCATACCCAGCGTCTTGAG
GTAAACCTCCCCATACACGGGCACGGCCGGGTATCCAGGCGCATCAAACTTCAGTATCAGGCCCTTCAACTCGTTTGTCATGAGAATCTCGAACGCGTAG
CTGAAGATGGACAGATGCTTCAACCAGCCCACGGACGTCGGCATGGTCTGCGAGTTCAGCAGGAAGCCGCCGAACAGCAACATGACCAGCAGAACCACCG
TCGCCCCGAGGTTTGCAGAGCCAACACTTCTCGATAGTACGCCCACAAGCAGGCAAATCGCACCAGCCGCCACGTTGAACAGCACCAACGTCAGCGAGAA
CAGCAAGAAACGCCCCGTCGTGGCCTGCAGTCCCATTATCCAGTAGAAAATGCTCGCAAAGAGCGAGGCAGGCAGTACCCGCAGCAACAACG