Description :
From Genome Similarity Track
Location :
contig_76:117373- 149537
Transcript NameFunction/comments
g12434.t1hypothetical protein
g12435.t1POM73472.1 Hsc70 cochaperone [Phytophthora palmivora var. palmivora
g12436.t1KUF78052.1 Mitochondrial acidic protein mam33 [Phytophthora nicotianae
g12437.t1RAW40520.1 hypothetical protein PC110_g3277 [Phytophthora cactorum
g12438.t1hypothetical protein
g12439.t1hypothetical protein
g12440.t1hypothetical protein
g12441.t1XP_009514115.1 phospholipase D-like protein [Phytophthora sojae
g12442.t1RAW40493.1 hypothetical protein PC110_g3285 [Phytophthora cactorum
g12443.t1POM62124.1 Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family [Phytophthora palmivora var. palmivora
g12444.t1XP_008903391.1 hypothetical protein PPTG_10447 [Phytophthora parasitica INRA-310

Sequence
32164 bases(100 bases per row)
AGGGCCATCGATGCACACGTCAACGTCCAGCACCTGCAGCCGATCTTCCGTCATGATGCACTTTGTTTTGACCAATTACAGAGCTGAGTTTATTTGGCGA
ATCAGAATAACTCGCTGGTTTTGTCGAATCAGCGTCGGCTTATGCTGACCAGTCAGCCTACTGTACTTGACATACAAACATCAAGTCAAAAGTCAAACTG
CTCGCGACCACTGCCTCACCGCGTTCACTATCGATTTTGCTTTGTGGACGAGAGTTGAATGAGAAGCGGTTTTGTGCATTATTATAGCGTTTACAGCGCT
GGCGATGGAGTGAAGATACCTAACGTTACATAGTGATAGGAGCGAGGACCGTTTTGGTCTCTCCTCCTTCTGTGAGCATTACACTTTGTCATAGTTACAC
TGACCATCCGCCAACCCACCAAATATCTGTATATTCCAGTAGTGATCGAGCGCATATTGTGCTGCGAGTGGTCGATGCTGAAGAGCGACGATATTTTTCC
AGCCAACCTACCCCACAGCACCAACACTGGCCCCCACGACAGTTGTTCTGTTGAGAATACCCCAGAAGTGACTTCACTCGATCACTCGTTGTACTGGTGC
GCAGTTTTCAAGCCTGGAGAGTGATGAAGCGAAACACAGTACCAACACTGCGACCGGGGTGCAGTTGTTCTGACTGTCAACGACCGTATCTGACTCCTTC
GAATCCTATGGCGTAGTGCTATAGGATGTTAGATCAAGTTGTGAATGGGTGTAGTGTGCAGCCTCTCCGCAGAACTGATGATTTATCAAGCCCTTATTTT
TTTTTTTTCAAGGGCAGTACCAACTATCTTTTCCAGGAGACCGTTCTGTTGAGACCACAGAAATGAAACACACCAGTATTGGAGTTTTGATCATATCCCA
AGGCCAGCATCGATTATCATCGGGGGCTACGTGTAGTTGTGTTGAAATCCAGTGGCTCACGTGCCTCAATCAATTGTTGTAACGTGGAAAATTTGATCTA
ATGCCCCATGCCTGAGCTAGTACTTCGACTGGAATGTGGCTGCCACGAGGTAAAAGTGCCGGATCGAACCAGCGACGCTTTCTTCATAAGGTGACCTTGG
TGAATTCTTGGCAGCAAGCTGAAAATGTTCCATCCTTCAAGGATACACGTGACTCCACTCGTCCCGGCCTCAGCGCGCACAACGCGCACTCCTTGCAGAT
GCCGAGCGCACAAGTCGTAGAACTCAAGCAGCAGATATTCCGTGCTTTTCTCCTCGGGTGCTTCAGGAATACTGTTGGTAGAATGATTTGGGTCATGTTG
AATATGACTGTGCCGTGCTGTTAGCTTTGGTGTCTCGGACACTCTCGACGTTGGTGGGTTCTTCATTGCTGCTGCCGCGAAAGGTGCGAGCGTAAATTCG
TTTGAAGACCCTGTTGGCCGCAGTGTATGGTGCCCTAGCACCTGGCGAGCTGCACCAGCCATAGCATAGCTAGTATCAGCAAATTCAGCTCGCAACGAGT
CTCCTTTAGCTTTCCACTCGCCAGCAAGTCCTCCTGGGGTCTCTAGCACGTGGGTGAGTAGTTCAAGCCACTGCGGTGATAAGACACTGCGAAGCCACTG
GTTCTCCCGAAGTGCGGCCCCCAAGTTTGTAAACGCCCACGCTGAGCTCAGCTGTTGCGAGTGTCTGAGCGCGTAGGCGACACGATGAAGCGACTTGATC
AGCAAATGCTGGCTGCTCTCAGCGTTAGAGCTTTCGCTTTGAGAATTATGCAGATTGTCGTGCTGATTATTTGGCTGTGTTGATACCGATTTACGTCGTT
GGTTCAGCATCACCGACTTCTTTTTCTTCTGCTCACGCTCGGCCTTGACTTGTGCGATATATTCCACGTCCTCGCGTTCATGAGCCAGGTCAGCTTCGAG
TTGATACGCGACCTGGGAGATAATTTGAGCCCACGCCTGCCGATTCAGCCGCAGGTCCATTTGAGTTCGACAGGACCAATGGGAACCAAGATTGAGATTC
TTGGCTACCAAGAGGTCCTCAAGTGAATGGCTGCACAACCAGCGCAGCGAAAATCGCTGCAAAAGGTGGTCAAACTGCATGGACGACGGCAAACCTAGCG
ACTGCATCACATGATACAAATCCATCTCTCCAGTGAACAGGATCACCAGTCGAACTACTGGCGATGACGGTCCAGGAGTTCCACTGCTTGATGGCCCCAT
GCGTAACTGGGGTTTCGTCGGTAGTGTAACAAACCAACGGTGGAAGAACGGTAGCGACTCGATATGATCGCGAAAAAAATCGCCCAAGAACCATGTTAAA
CGATCGACTAGAATTTGAGCGTCGCTGTCTACAGTAAGATAGCCACATACAAACTAATTAGATTTTTCCTGTACGGTTGCCAGTACCAGCAAATGTACCA
ACCTTTCGTGCCACTCCGACAGGCGAAGTCGATGTACATGAAGCATTCTGCACCACGCTCCAGATATTTCAACTCGTGGAGTGTGGCAGCAGCTGCACAT
TGCATAGTGTATCTGGTTAGGTCAGCTCCCAACTCAAACAACAAAAATCACTTACAGTCAGCGTCCGAGTTGTAAGTGAGATGAACGGTAGCGGTTGTAG
AAAACTTGTGCCCTACGTCAACTTTCACCATATAGTCGCCTCGATCGCCGCCAGGAGTGCGAGACAGCAGACAACTCGCAGACAGCAGCCCTGTGGCCGC
TGCTTGGCGCACATGTTTAAATATCCATTGAACTCGTTGCTTGAGTCGTCTCAATGCGCAGAAGGAATGCAAACGGCACTGCAAAAAGAATCTGCGCCAG
CGCTTCACCACACCCACGTCTCTATCAGCACAGAACCAGCTTCCAAGTAGCAGAAAACGCAATGACTAATCACGTACCTACCGTTTTCACAGCCGGACAC
CAGGAAGAGGACATCAAGCTCAGAAACCCAACCTTGCAGATTCGTGGCTGTTCCTCATTGTGCTCACTTCGAGCATGCCCTTCATTCGTGAATCGTAGAG
CCGACTTCTGACGGTATCCAAACAAACGCAAAGTACGCTTCAACTGGTGTATAAACCTCAGACAACGTGCGAGTTCGTATCTCTTGCCAATGATCTCCGC
CGTCTCGTCGCCCGTTAGGACAAACCCACTCTCGGCCAGCAAATACTGCGCAGCTTTAGCCGTCACTGAACCCGTCGGATCATCCACATACGCGTCAAAA
AGCTGTTTCATCATCTCCACTCGCTCGAGCTCTTCCCACTCCAACGAAATCCCCAACGACGCCAAATCTCGTGTCAACGGCTGTTCGTCCTCAATCTGCT
CTCGGTACATGACAAACCCTTGGAACGTAAGCCTCCCTTCCTCGTCCAGCTCGCACATATCACTCATATACATTCCCCAGACCTCTGCGCTCTCTTCAAA
CGCCCTCAACTCCACCGAATCGCTCGAGCACTGCAACGCCGCCATGTACTCCAGGAACTCTTCATGTGTCCACCTTTCGTCCTCATCTGCGTCAAAAAGG
GTCCAAATCTTCCGACACTTGGCTTCTCCCAACGGCGACAGTCTCCACTCAAGTCGAACTGCATCCGGAGCGTCGAAATCAAAGCGAAACGCTGCATAAC
TCGTCAAACTCGCCACAGTCCGTCGGAACAAGGAAGTGGTCGGGTTCCAATGGGTAGCGGGCGACTCCAATAGGTACGCGCTATTGTATCCATGCGTGAC
AGCTCCAGCCTCCCTCAGAGAGTTCTCCACCGCCCTCAAACTGGATCGGATCTCGTCTCTGCGCTCCAGAATCACCGCCTCATTCGCGGCCAGCGCCTCT
TCCTCCATGTTGATACAAAATGTAGCCATCTGTAGTTGAAGCGGTGCGATCTTTCGTTTTATTGGTAGAAAAGATGGATTTCCAACCAATTAAAAGGATT
TCATTTGGTGGAACAAGGGGAGAATTTGATTCACTTGGGACCTGATGGACGAGGCGAGTAAGGCGACGCTGTTCAACGCGCTGGCGTGGGTGGACACGCT
CAAGACGCGTGAAGGCGTGGATGCACAGGAGATCGACACGGCGCTCTCCCGTCTCACGTAATTTCAGCATTTTGCTTGGTCCTACAAGCTGCAAAATCTC
GATATGATGTGTTTTTCTAACGTAACAGTTTACTTTTTTATTATTATTTACCACATAGTGAGGCTTTCGGCGTGGACGTGCACGACGCCGAGCAGCGACG
ACAGCTGGCGGTCGACAGCGACATCTCATTCAACGAGATTTTTGCTGCGGGGCTCAAGGCGCTGAACCTGGAGACTGGCGCGAAGGAGGCTGTGGACGAA
GATCCTGTCGTTAAAAAGCGTACGTGGATGATTTTTATAAGAGAAGGAGGAGAGCGCTGATTGGCTGCTTCTTTTCTTATTTGTCAGACCCGGAGCTCTG
GAAGAAGTGGGTGGCCAAGCTGGAAGCCAAGGGTTTCTTCAAGGACGCGGCCCCTGGCACCAGTGAACATGCTACCCGTACGGCCAAAGCGCTGGGTAAA
TTTAAGGAGAAATTCGGAGATGTGAAGCCGGAGCTTTCCCAGGAGGAGAAGGAGGCCAAGGCGGAGGAGGTGAAGGCCCAGGGCAATGCGGCTCTGAGTC
GCCAGGACTACGAAGGAGCTGCCAAGTTGTATCGAGAGGCGCTGCAGCTGTCACCAGAGGGACCGTCGTCGCACATTTACCACTCGAACTTGGCTGCGGC
GTTGATGTACCTGGGCAAGTACACGGACGTGATCGACCACTGCGAGCAGTCGATTGTGCTCAAGCCGGCGTACGTCAAGGCCTACTCCCGGTTGGGCAGC
GCGCAGCTGCAGCTGCAGGACTTTGACGGCGCTATCGACTCGTTCCGTCGTGGACTTGAGGTGGACAGCTCCAACGCTGCTTGCCGTGACGGCCTTGCAG
ATGCTGAGCGCAAGCGCCGCCAAGTGCAGACGACGAGTTCTTCTTCGTCAGCTACACCCCCTGCTGGTGGCGCTGGTGGCATGCCGGACCTGTCGAACCT
GGCCAGCATGCTGGGCGGAGGTGGCGGTGGCCTCGGCGACCTCATGAACAACCCGCAGATGATGCAGATGGCCCAAAGCATGATGCAGAACCCGCAGATG
ATGCAGATGGCGCAGAATATGATGCAGAACCCCGACATGCTCAGCGGCCTCATGGGCGGCCTTGGCGGCGGTGGTGCTGGCGGTGCAGCTCCCTCTGGCC
CTGGTGCTGGTGGCATGCCCGACATGAGCGGCCTCATGAACAGCCCTGAGCTCGTGGCGGCGCGATCCGACCCGGACCTGGCAGATTTCTTCCGCGACGT
GGACGCCGAAGGCCCGTCGGCCGCTATGCGCCACATGTCGAACCCCAAGGTCTCGCAGCTCATGCAGAGCGTGATGGCTGGGATGCAAGGTTAGACAGGA
CAGCAAGCAATAGCGACGCAGCCGTTCTACTGCTTGCAGACGATACGAGGACTGTAAATGGCAAGTGGTGAGTGAGGCTCTAACTGTTTATTGTGTGCGG
TGTGGTCGTCACGAACCTCAAGCAGCCTGTACGGTATGCAGCAATACGGGTTTAGTGCTTGACGAAGCTCTCGGCGTCCTGGAGGAAGGTCAGGTACTCG
CGCTGCTCCTTGAGATCAGCAAACTGCGCGATGAACTGCGCCAGCTCGTCGTCGATCTTGCGCTCGGCCAGGTAGCCGTAGAACTTGTCCTGCACGTCGA
GCTCCAGGTCGATGAAGTTGGGCCCAAAGTACAGCGTCTCGTCCTCCGCGTCCTTGGCAAAGTCGCTCAGGTAGCGCACGCGCTCCACCGTGAGGTTGCT
GCTGGCCACGCAGTCGAACTGCAGGCCCTTGTTGTCACGGGTCACGTCGGCCGTGAAGCGGACGCCCGGGAGCTCGTCCTCCTCCTCTTCGTCTCGTCCT
GCTCCTGCTCGTCGTCCTGCTCATCGTCCTCATCCTCGTCGTAGTCCTCGTCGTCTTCGAGCTCCACAGTGTCCTGGGCATTAAACTTGATCCTGATGGA
CTCGGAATCCACCGAGCCCTCGAGCAGGACGTCCATGCAGCCAGGAGTCTCCTTGAGGGCGAACACCTCCTCCACCTTGAGACGCAGAGCCTCCAGATCG
GGCTCCTCGAAGCAGTTGGCCTTCTCCTCGGTCACTTCGCGCTGCAATAGGAAAGAAGTAGGTAGTTTTAGGTTAGAACGCGGTTTTTACTGGATTGCGA
GCGGAATTTTACGAGTTGCATGACGTACGTTGAGAATGGACACGAGCGTCGACTTCTCGCGGGTCTGCAGGGCACGCAGCGCCACAGAGGGCGTGCGGCG
TACGGCGGCGAATGAAGCAGCGCGAGCAACTCGGGCGAACATGATCTCGTCCTGGAAGATTTGAGAGTGCGGTGGAGCAGCTTGGCCACATACTAGATGG
CGTGTGATTGGCGGAAAAGAATGGGTTTCAGCGAATGAGGAGAGCGAAGGGCACGCTGCGGTGCCCCATTTTCAAGAAGAACTCACACTTTGGCTTTTTC
TTCGTTGCGGTTGGACTTTTTCTTCGTTGCGGTTGGACATTTTCTTCGTTGCGTGTGTGCATTTTGGTGGCGAGGATGAGAAAACGATTGACTCTCGAGT
TCCGCGACAACCCCCCCGGGTTTCAGATGCATTTGGGATCTTATTAGGCTGCGAGTGGACAGGAGAGCTCCACGGTCTCACTCGTGCGTAGGATTCACCA
ATTGACCGGGGAATAGTACGAATCTCCCATTGTAAAGGCTGAAGAGGCTACTGCGAGAGCCCCACGCGTATGTTCTCTAGATGGTGGGAGGGACAGTTTC
CAGCAATTGGAAAAACAAACTTTAAGAAGGAGGAACTAGGAGAGAAACAAAAAAGGCGAAGCTGAGCCACCAATTCACAATTCATGTTGAGACTTGGTAG
AGGTAGATACTGTCAAAGTCTTGAGCGTCGTCTACATGGACGAGTTGACTTTTGTCGACCGATTTAGCAGACAACCCCCAACGAGAAAGTAGCGGCGCGA
TTGATCGGTTGATACTTCGCAGTTGGTACGACAAGTAGAACTGGCAGGACGTGCAATTGCTGCAGCGGAAGATGAGAGCGACGGTGGCCAGCACCTTCTC
GAAATCTGCAAGTTGAGGGAGTTAGATGTGGTTTTACAGTTGATTCTGTTGCGATTGTACCTTCAGACTGGTAGAAGCAGTCGGCGGCGAGGATGACTTG
GACGCTTCGGAAGATGGCGAGCACTTTGTCCGGTACGAGCATGTCGCCCCAGGTGAGTCCAATGAACTGGGCACGATCCTCGAGACCGTTTAGCTTGATG
TTGACTTCTGCGTTGCGCTGGACGTCGACAGCGTCGGGTCGATCGGTAAGATACACCTTCGTCGCGCCACACAACCCAGCGAGGATCGACGGGAGGCCAG
TGCCGCAGCCCAATTCCAGCACAACTTTGTCGCGACACAGCGAGTCGACTTCGCGGGCGACAAATCGCGACAGCAAAAGTGCGGACGGCCACACAAACAG
CCCGTAGTGCTTGTCATTGTCTTCGTTGGCCTCGTCGAGGTCACGGATAAGCTCGACAAGCCGCACGTCGACGATGGAAGTCTCACCAAGGCGTCGCCGC
TTCAACTTCGGCTCTACAGCCGTCACCGCACCTTGAGCTTTATCCAACGGCACTGCTAACGCCGCGTCATCACCACACGACCCACACACGAAGCTGAGCG
TGCGTTGCGACGCAGCATCAGCGCTCAAGGCCTCCATGCTGCTGCACCAGTCACGAAAACGGGACGGAAGCGATGAGCTACCCGTAAACTACTGTCGACG
AACAGATCCACTTCAACTTGGGAAAAGGATCTTGAAGCGGATTCACCAATGCCGGCAACGCGACGGTTGGAACTGACGGCTTTCGACCCGCAGGAGCAGT
ATTGACACCAAACTCGAAGGAAAACGGACTTGGACATGCAGCAAGACGAGGTTGACCAAGCTCTCGACGCCACCATCTTGCTGCCTGATGAAGAAGCCTC
GCTGTCGAAGCAGATCATCACGAACTACTTCACTAGCGACGGACCACGAGCAAGGAGGCTGGGTTCCAGCGACCTCGAGCCGGAGAGAAGCATTTTGGAT
GAAAGCAGCGGAGACGAAGAACTTCGACATTCTGGGAAGATGCCAGCCGAAGTACTACATGAAACGGAGAGAGAGCCATCGGAAGTATACGAAAGGGAGA
CCGTGAACGCTGGAGTTGATGACCGCGAGGAAAGAGCGATGGGGATGCTCGAAGAAATACTGACCTGGGAAATCGCGCTGTCAGTGGTAGTCGTGATTTT
GGCCCTGGCGCACTGCGTGTGGATGTGGAACTTGGTGGAGCTCAGCACTTTGAATTTGGAGTTTGGAGACTAGAAAGTGTGCGCAACGAATACAGTTGGA
GATTTCAGCATGCTATGATGAACATGCTACTGATCTGTCTGTTGAATGTGTGCACTACCTTGCGCTGTGGAGGACTATAGCTGCAGACAAGCTTCGATCT
GTTGCTGCATCCGTGTTACGTGTTGACAAGAGAGGTCTCCAGCACCTTCTAGGCCTGGGGTGGCACACGCTGCCTCGTGGAGCAAGGTTAGCTGACTTGC
ATCGAGCGTTTTCAGCACCTCTTGAAACAGGGCGTCTTGATTAGCCACTCCGTTGGGCTCTTGCATCTCGCCGACTGGCGATGGTTGCTGAATTTCCTCC
TCCTCGTCCCAGTTGTCCCAGGATTCAAGCGCTGAATTTTGCTTTCCATTAACACCAGATACGGTGAGGGCCTGCTGTCGCTGGCTGTAAAGACTGGCAA
TTGCAACCAGTAGCTTCTCCTTGTTACAGTTGCCGCTAGTAGTGTATGACAGCCACATTTGCAGATAAATATCCAGCAAGTTGGTGTACGTTGCGTCTTT
GATTTTGGTCTGCGGAGCACCAAAGGTGTCACTGAGGCACTGAACAATTTGTCGAACTCTTCATATAGTTGGTGAGAGTTCGGGGAATGAAGTAGCATGC
TAAGACTTTCTAAAGGCTGGATTGAGCCTCTGACTTGTTCATCGTGATCCAGCGAAACATGTCGTGCACAATAGCCACGATAGAATGATGCGCTCCAAAC
ACAGCCATCGAGAATACCACGACAGGCCAAAGTCACGTGGTTGGACATCATCTTTTGCGGTTGAATCCATAGTTTCAGCCACGTAGTGCATCGTCGAGAC
AACGACCGGAAGCATAGGCACCAAGAAAATGCTGAACTGACGATCCAGTGAGCTATTGGCGCTCACGGTATTTCCCATTTGCGTTCCTAGCTGCAGACGT
TGGGGGAGATTTGCGTGCATCGCTCGTAGCGCGCCATCTAAAAGCTGAGTTAGCTGACGAGGTGGATCTGCTGTTCCTCCGAAACAAAGGAACGCTAAAA
GCCTAATCTCTACTTGCCCCACTGCTGTTTCTGTATCAAGCGGAAAGCTCTCCGGATTCATTTCCATTGCTGCGATGCCGTCCCACACAATTGTCCAATC
CTCTACTAGTTTCTGCGAAAGAGAACTCGAAGCACAGCTACCTAAGGCATCCACACTTTCTTGCAAGTACCGTAAGTGCAGCAAAGTGAACTTCGCACAC
GCACAGCACCACGTGTGTCCGCAGAACCGCTCTGAAACTCAGTAGATGAGAGAAATTCCAGCTGATCGGTCCAACAATTAGCCTCATTAACCCAGGAAGA
AGCTGCCGAGAGATTCTGCGAAGCTCAAACTGTGAGGACTCGAATGCCTCTTTCGTGTGAGCGATGCATCCACTCAGAATCTGCTGCCAAAATCCTTGGC
TTGAAGCAGGTAGGTCGTTTTGGCCACGATGCGTGTCCACCCAATCGCTAATAACCTGGACAATTGACAGGTTCTCTGGTTCCTCCTCTACTTCATTGTC
ATTTAGCACCCATGTCGCCCGCTGAGCTTGATCGTGTGCCCACTGAACTGCTTGCAAGTGGGAAAGAGACGTTGATCGTCCTTGTCGAAGATTGGTAGGC
ACCGGTTTCCACCTCAACAACTCATTGGATTGACAAGTCACAAGACTTTCGCCAAGCACGTTCATAAGGACTTCAATGCTCAAAAGACGACCTTCTCGTT
GTTGCCAACAGAATCAATTGCATCTCTCCGTTTGTTAGACAGAGAAAGTAACATCTGCACAATCAGCTTCAAGGAGGCCTCGTCAAAGGCCGAATTTGCG
CTTGGCTCCAATTCGTCATCCACAGACTTTCCTTGCTGGATACCGCTCAAACCAAGCTTTGCCAGCGCCAACACGACGCTGCTGCTCTTTTGACGAACAC
TGGATGCGATGTGCATGACGTATTTCTCCAGCGTTGGAAATACGAACTTCCAGTGCCTTAACAAGAAGCGTGAGGGGAGACATGGAGCCATCCGAGCTAG
GACATCCAGTAAGCCTTCCGCCTCAAACGCATCCAGAAGTTCTGACTCGCTGGTGTTCGCGATACCGTCACTCTCATCGACCTTGTCATTGCGGTTCATG
CGGTTTAACTTGCTGATCACTTCCTGGAAAATGAGTAGCCGTGTTGGGGTTTCACAAAGTGCGGCATATTCCACCAAACATTGGGCCGCAAGCTGCCGAA
CAGTAAGCTGGTCGTGACGAAGACACTGATAAATGGCTGGCTTCAGCGTTTGTACTAGACATCGCGGCAGTTGAGTGAACGTGTGACGCTCATTCGCCCA
AGTCGATATCTCACTGCTGGCGATTGACGGACGCCCAATATGCCCTTGATATCCTCTTTAACCTGAGAGGTCTTGGGGTTTTCGGGTTGTGGAGATGTGG
AGTCCATTTTAATGGAGCGCAGAAGATCTGACAGCGCCAACAAAGCTCCTTCTCGCTCCGTCCACGCTGTCACTTGGGTTTTGTCGGCGCTCACACTTCG
GGAGCCGACAGCGACACCGAGCAAACTGTCCATAAACTGCTCGATGTGATTTAGGGATGGAAACTCAAACGCGATGGCTGCTGCATTCTTCGCGCAGTCC
TTCCGGATTGCAGACCACAAGTCGGTCACACCAAGTAACAGCAGCCGAACTGCTTCATCAAAGAACTTGACATCAAATGGTGGCGATGACCCCGCGCGTG
CAGCCTTACTCTGCGATGCTTGCCGGAGTATTTGGAAGGCGAACGTCAGAAAGCGTTGGCGAGCCCGAGGATCCTGAATTCGCTTCACGACTTTATTCAG
ACTGGAGATAGCAGCAGCATCCCACTCGTTGTCAAGCAGCAGTCTATGGTACACATCGCAGGTTAGACTAGACGAGGCAACAGTTATGAGACCAATACAT
CACAACACACCCATGCAGCACATCGACAAAGCTCTGAAACTCGGCAACGTCGCGTCCCTCCCAGTCGACAGAGATTTGCTGTCGATCCCTAGAATCAGTT
TACCTCCTGCAGAATCGGTCGTAGCTCGAAACTTTCGGACCACCAAGTAAAGTAGCAGATCTTCTAGCAATGACTGCGAGTTGTTACGGCATTCGTCGTC
GCTATCAAATTGCAAAACAGGAGACTCGCAGCTCAAAGGGTGACGTCTATCTGCAGTTTTTCACTTGAATCCGAGGCTGCAGCAATCGACGAAAAGGCTC
CGAGCTCCTCGTCGTGGCCTTCAGCTAACAGCAACGCCGCACCGACGCCATGCAGCTTGCTCCGCTCTTACAGACTGCGACTCCTGGAGGTGAGGGCGGT
TTTGCACACGCATGAAACTTGCACATGCATTAATATACATGGGTTTGGATAAAACCATCACCTGCAAGTAGGCAACCGACGACGAATGACGCGGTGGCCG
TTCAGAAGCGTCTCGTGATGCTGCGAGCGCACCGAGACTGGAAAGAGGTTTGAAAGCGGGAGTGAAGGAATTCAAAGGAGCACAACTTCAACCGTCCAAA
GTCGGGTTAGGCCCAGGTAGGATTGGCAGGGGGCCAAACTACGACCGGACATTGTTCACGCACCCCATTTCGTCGTACGTACCGCGCAACGGTCGCAATC
ACGGATTGTGCCTATGCTGTGCCACAGCCTGTGCGTGAGCATGAGAGCAGATCAAGGTGATAGATATCCTGTTCCGCTCGTGATCAGTGTCGCCAAGTCA
TAAACTGCGGTCTGTCGCCAGCTATTCGTGCACATTCGGAAATTCTAGCGGAGAGCATCAAGTGTTTGGAGATAAGTGCTATCGTACATGACAACGCTAG
TGATGAGTTGAGCGCATGTAGTCAACTTGCTAGCCAATTATCTGTTATGGTTGTCAGCCTCCTTCCTACAAGAGACTGAGATTTCGAGATAGGCGCTTCC
CGGTTGTACACCGTAGCGCGATGTACTTGTTAGTAACAAGTAATGTACATGTACCAAGTACACAAGTTGTTGCCACAGTCACGAACGCACAGAAAAACCT
ACGCATACATGTATCGACCGTGCTGGGGAATACAGTGAGTGTATTGCCCAGCACGATGTATTTTGCACCTCACACAATCGAATTTGCCACCACCAACGCC
GTTCTATTATACATGATGCGTGATTTCTTGGTCTGCTTCACACTCGTAGCCTCCCTCGTTTTCTCCGCGCAATCGCAGACGACTGTCATGGTGACTTCAG
AATCCCAGTCCAACGCTCGCCCAGTGCTGTTGCTTACGGGAGATTCGCTCACAGAGCACGGCACGTACCCCTCGATGCTTGGCTGGGTCACGCAGTTGCA
GGCCCGATACACGCGCTCGGCCGATGTTATCACCCGTGGACTCTCCGGCTACAACACGAAATGGTTCCTGAAGTACGTGATGCCCGTCCTCGAGCAAGAG
ATCAGTACCAGGAGCTACACCGTTCCGTCTCTCATTACGGTTTGGCTTGGCACCAACGATGCTGCGCTGGTAAACGGCAGCAACTCGGAGATGCACGTCC
GTATCGAGGACTACAAGGAAAACTTGATCCAGATCGTCAACGGATTCCAGAAGACAGCACCGAATGCGAAGCTATTGCTGATCACCCCACCACACATCGA
CGACGGTGCCAGAGCCAAGTACGCAGCCGAGCGAACTGATTCCAAACGCGGTCTCGTGGATCGCTCGAACGCCATGGCGGGAAATTACTCTCGCGCTTGT
GTGGAAGCCGCCGAGACTCTCAAAGTTCCTTTGCTGGACTTGAACGCACATTTCAATGCCATGCCCGTGGCGACTCGAAACGCGATGCTGGAAGATGGGA
TCCACTTCAACGCGGAGGGCAACAAAGTGGTCGACCAGCAGTTGCAGAGCAAGCTCCAAAGCGAGTTTCCCGAATTGATGACCTCGTTAGATACTTGGCA
GGTCCCAGCGGTGAGCAAGTACGTGTCAGAGGACCCGTGGAAGCCTGAATAGGGGATATTGGACGAAGACTGATACTGCCTCACAGATTGGCCTAGTGAC
GGTATCCGCCGTTGATGACTGCGCAAGTAGCGTCCTAATCACCTCAAATGCTTCACCTGGCGTGGTTAAGGTCGTAGTCGCTATGATGGCACGGTTGTCG
CTCTTGCTAGAGACCCATAAAAATTCCCAATGGTTTGTCAAGTTCGTGAGAAGTGCCATCACTGGTTCCTCGACGATGAAATCCAATGTAATCAATTCCG
ACAAAGCCTGGAACTCGGACGCTGATTTCACCTCCCTTTTCACATTCTCACTCCAGGCAAATGATGCAAATAATGCGGAAACTTCTGGGCTATAGCACTC
AGCACGATCATATCCGTGCGACCAACAAGATCAATATCGCGACCAGGACTTCAACGGAGAGGATATTTGCGCCTTCTTCCACACCAAGCACGCAAAGTTT
GTTGTTCCTCAAAACATCGCCAATGTTGGCTTCCACGTACTCACGATAACGTCCACTTTGCTGCTCCTCGGTACGGCCCCCTATCCACTCAAACTCTTCA
GCTGGAGTCGGACTTCCACCGGTGAATGGAACTGTGTCCACAGGCGCAACCCGAATTTTCAACTCTTTCATAGGGTTGTTTCCCTTGGTTGAACTCACTT
CCGAGTGGACATATCGCGTACGCTTGGACAGCACAGAGTGTTCATACAGTTTGTCGACCTTATCGACTAGACGATCCATCCTGGAAGTCTCGCTCGCTGA
ACCACCAGCCCACCGCCAGCACGTGAATTTGCCTTGGCTTTGGAGCGGTCATGTTGTTGGCTATCAAGACATCCTGAACTGCCCACGTAGCCTTCAGCTG
CTCTTCAGTGGTCACCTTTCCTATCCAGTTGGAGAGCAACAGAATCATCGTCTGGCAGCCACGCGCCGGTCGTCGTCTTCGCCAGGAAGAGCTGTAGGTT
ACGGGCAGGACCCTTGATGTCTTCGTTCTCCGCCTTGATTGTGTCCTTCAAGTCATCCACCGAGTCGCTTTCATCTACTCGCACCGAGAAGGCGCTTCCA
GCGACACCGACGACGGCACAGAAGAGAGTGACCATCTTTCCTTGAGTCGCGTCAGTGGAGGAGGAGGAGACCTGATTTTCTCGAAACGCCAACGCCGAGG
CCAAGGTCGTGCACTACCTTGGATTGGTCGCCAGACCAGGGGGTTCGCTGGACATCTGCAACATGTCCATAACGAACGATCACATTGGGGAGGCCATTCT
GAAGACGCTTGCAGAAGGCTGCATCACTCGCATGATCGTCGACGAGCAAAGCGCACTGCAAAACAAGAAAAACATGTCGTGGCTACGCAAATTCAAGGAC
GCGGGGATCCCGATCAAGACTGGGCGCGTGGCCAGCTTCATGGTCCACAACAAATGGACGATCGTCAACGGTGAGTTTATTTTACAAGGCACGGGCAACT
ACAGCACGGCCGCGTTCGATGGAGTCCGCCACGCAGAGACATTTGAGACGCGCACGGCTCAGGCGCACCTTAATTTGATCATGCGTGAGTTCGAGCTGCT
CTGGGAAGAAGGACGGGTGCCCAGAAATTCTCCATCCCAGAATCCCAGAACAGATGTTTCGTGCAGGGCACGTGTCCTACATTACGGGTGCTGGTAGGGG
AGTCGGCTGACAAGCCTGCTCCCCTCGTCCCCTGGTGCCACAACGCCACACCTGGGCTGCAAACTCTCTCCTCGTTCGTGCATGCTGTAATAATGCGCGA
CCGTCCGTCGATTCCAGCCCGGGTGCTCCTCGCCTTGAAGCATCGGAATCTAGTGGTACAGTCTCAAGATTTGAACGCTGAAAACAAGAGTAAGACTTCA
CAAAAAGCAGCTTCGGTATGTTACAAGATGAATTGGTGTCTGCTCTCGTTCGCGTCTACTTCATGCCACTATCAACTTCTAATACATTTCGCTACATTTC
GCAGCGTGCTTCACACTTTACAACTTGGTCACACCTGACCGTTGGCGGACGTGCTCGGAATAATGAGCATGGAGTGGCGAGACGTTCGAGACAGGCTGAT
CCTCCGGTGCGAACTGTCGTACGGCGTGCTCAATACAATCTCCTCGCCCTGCTCCGGGTCATCGTGCATCACACACAAAATTGATCCGTTGTCGCGACTG
GAAAATGGATCGAACCCAGCAGCAGAGGTACCGAACATGGCTACGCGTGAAGGCGGAGGAGGCATCGGCAGGTTCTCAGCTGCCAACGTTTCCATAAGTC
GGTCGTAGTCAACCGAGTGGTGGGGGTAGGTAAAATCCATGTACAACATTACTGTGGGAAAAATATTGTTTCCGATCGGGCATCCGTCGCATCGAATCTA
CATCGTCTTCTAGGTTTTTGGCGTTTCGCAGTTGCTAATGTCGTCTTTGTGTTGCTCGGACTTCGAACAGCACATATGTAGCGCTTGCTCGCTCGACTAC
TGGTACTGAAGTACATCTTTACTGTGGCTCTCGGTCCTAGAGAGCTCTGATGTTTCTAAAGTTCTCACCAAAATCCACAACTCAGCAAGTTTCCCTCACG
GAAAGCTACTTCATTTCAAGTAGTGCCTACAAAGATAAAACTCTTTCTCCGTCAAACAAGTTTCCTCGTTCGATAGTCTTTTCCCCCCTCTTTTACTCGG
GGTGCATTTCACGATGTAATTCTGCGGATTGCGGCCAATCCAAGATGAAATTCATTGCAGGAAGCCGTGCTGAATGGGCTACATAGGTGGTGTTTACACT
AGATCCACTCAAATAAAGAAATCCCTCGACCACATCGGCTAAACTATCGGGGCATCTTAGATGTTCCCTCTTGGGTTCTCTCAAACCTTGAAGCACACAC
CTTGTAGGCGCTCTAAAATATATCTATAGTATAATTACACACTCTCTCTCTCTCATCGGTCCTCGTCAGACCCATCCTCTGATGTCCACGGGTCTTGAGC
CGCATAATTGCTCGCTCCAGGAAATTGCCACAGCTCCAGCTTCGCTGCTAAGCTAGGGAACTCGTCTGCAATCTTCGTTACCACCTGCAGGTACACGAGC
TGGTTGCCCGAAATGTTGAAATGCAGACCGTCGGACGTCAGCAGCAGCGCGTCCCGCGTCGACTCGTTCATGGCGTTGAAGTACGAGTTCAAGTCAAGCA
CTGGGACCCCGATACTGGCGCCCGTTTCCACGCACGCTTGAGCGTATTTCTTGGCCATGGCGTTCGTGCGGTCGATGGTGCCGTTTTGCTCTTTGGCCAT
TTCGGCTCTGGCGCTGTCGTTGACATGCGGCGGCGTGATGAGCAAAATATCCGCGGTGGGTGCCGCCCTCCAGAAGCCGCTCACGATTTTCTTCAAATTG
TCCTTGTAGGCTTCAATGGGGACGTGCGTCTCCGAGTCGTAGCCGGTTGCCAGTGCAGCGTCGTTGGCGCCGAACCAAATGGTAATGAGGGACGGAGTCG
TGTACACGCGCTTCCTGATTTCGCGCTCGATGGTCGGCGCAATGTACTTGAGGAACCATTTCGTGTTGTAGCCCGGGAGTCCTCGCGTGACGACGTCAGC
AGTGCGCGAGTATTTGTCCTGCAGCATGGCGGCCCACCCGCTTTTCGCGACGTCGGTGCCGTGTTGGGTGAGCGAGTCACCCGTGAGCAGGACCACCGGA
CGGGGATCCGGTTTCGTATCTGCGAGCGCAATGACAGCCAAGCGACGACCGCCGCCGCAGCGAGGAAGCCGAGCAGGAGGCACTTGGCGCGCAGGGTCAG
CAGCATGGTGGTGTGGCTGTCGGGCGCAAAATGTGATTGTGGGGCGACCGTCGTCTCTGCGCGTCGGAAGATCCATGATGATGCACGAAGCAGGGCAAGT
GTCCGGTCAAGTCATAATCTGCGACGGATTTCCAGCGTATGAAGGAGAGTACGGAGTGAAATGGATAAGCGGATTCTCAATGATCCGTTAGTGTGCTTGG
CAGCCCAGCCTTGGCTCATCAGGACGTCCGTGGTGCGGGGCAACATGAATTGTACATGTAGCGGTGAAAATGGTGCTTTGGAGGCATCCTGTGGCGTGTC
GCGTACAGTGTACTGTTGGGGCGTAAACGTTGGATGTTTCTGGTGGTCAAATCCCTGAGGCGAGGCCTGAGTTCAGTCAAGCAACGCTAACCAATGCTCG
GTTCGTCGGCCCAACAAACCGCGCATTTGCTGCCGGCAGCTTGACTGTTTCGTTAGAGCCGCAGTAGCACTGATATATGGGCTTTCAGTGTTTTACTCCC
TGAATGTCAAGGCAAGTGGTAAGGATGAATACAATAGTAAGGATGAAGCGACACAGTCCATTCGACTGAGCGGGGGGGGGGCAGATTTGCTCTTGCTTCT
GCGAAACCTTACGATCATTTTCGTCACCAGCAGGCCCGCACTGCAGGCAGATCTCAAACTCCTTTTCGATATGACCGTAACCTTCCTAAATGATTTGATA
CCAGCTCAGTATGATATAATCCAGAATCTAGTACAAAAAGAGCCAGATTTTGTGTGTTAAAATTATATCTCATACAGAACCGGCACTTTAGTACGGATAA
AATCTTACTTTAATCGCAAAAGTCCGTACATTATCCTAGATATTGTTGGGATATTACGTCCTACGCATATCTAAAAAAACACAACTGAAAAGCAGCTTCA
CCTCTCGATCGGCACCACAATGTCACACCTGGGCTGCAAGCTCTCCCCCCGCTCGTACATGCTGTAGTAATGCGCGACCGTTCGTGGGCTTCCAGCCCGG
GTGCTCCTCGCAGATGGCCTTGATGTCCTTCTTGCCGGTCTGGAGGCTGGGACTTCTCTAAAGGGAAAAAATGTGAACTCTACGGTTCACATTTTTGTGG
GCCGAGCTTGTCCACGAAGTTCTTGAACTTTTTGGCCGGGTTCTCATCGCCCAACACGTCCGGGTCGACAAGTTGCCGCAGTCCGTCCGACACGAGGTTG
AACTGCGGCTTAAATTCCACGGCGTACGGCTCGATGATACTTTTACGTCGTCGTGGCCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCG
TCCAGCTCGTCGTACGTGCGCTTGGTGGCCTCCATGAACTTCTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGAGACTGCACCA
GCTCCGTGTCCACGATGTTGATGCCGATCTCCGTGTCACTCGTCATGCTGCAGCGGTTTCAGTTGGCCGAGCCCAGGGACACGTACACGTCGTCCACGAT
CACCAGCTTGCTGTGGATGTACAGCTCCTTGGACTCCTTGGTCGAGTACAGCTTGAATTTGTCCGGGTACGCTTCCTGGATGGGAGATACCATGTCGTAC
AGGTACTTGGCGTAACCCGTGTACTCGGCTTCAACAGTGCGCTGCATGATCACGATGAGGCGCTCAATGCTGGGCATCATGTCCATGATGGCCTCCAGCA
GCTCCGGCACGAGAATGAAGTACTGGTCCTGGATGAAGATGTAGTTCTGCGCGTTCCGGATCGCCTTGATGCGTGCGTGGAAGATGGACTGCTCGCCTTG
CGGCGCGAAGCCGTAGTGTTCGTAGTCTGGGCTGAAGGTGCGGCATAGCTGCACGGCGTGCGTTCCATCTTGGGGAATTTCCAAGGGAACGTCAGATTCA
TCGATAGGGGCAATTTCGAGTAGTCTGGGTTCTCGAAGTCAAGCACGTCGTCAACTAGATCCTGTGACGGCTTGGGATCGGCATTCCACCGGTCCAAAAA
GTTGGCCGCAACGTCCTTGGAGGCCGGACCCACAACGCGAGCATGAGCGTCCAACCAGCCGTTCCACAGACACTTGATGCCCGTCCGTTCACGCAGCTCG
GCCTGTCGTGCTCGACTGTGTCCCAGCGGTCGTTGGTCAGATCCACGCCGCCCACGTAGGCCACGAGGTCATGGCCTCTACGGACAATCACCGACTTCTG
GTGGTGCGACGATGTGGGGAACGGCAGGCGATCATCGTACACGAAGCGCGCAGGTCCGTACTGTTCGGGTGGAGGCAGCGCGTTGATGAGGTCGCGCACC
TCGTGGTTCTGCGCACGCTCCGTGAGATTGGACCACACGAGCATGCGCCAGTCAGCGCCGCGCTTCACGGCACCCTCCGCTAGGTCGCAGAGTTTGGTAT
CAGGCTCGAGCGGCTTGAACGGCACGTTGCATGTGCCCCAGCCCGCGAGGTACACGAGGTCTCCGCGGCGCACCTCCATCATATCGTTGGCCACGTCATT
GAAGTAACCAGCAGAGGCGACGTAGAGCTTGACGCGGTTACCGGTCGAGTAGAGCTGAATGCCGTCACGCTGATGACCAGCACGGGACGTGAGCATTTCG
CCTTCAGTGAGAAACCAGCGCGTGGGCTCGAGGTAGGGCTGGTCGAAGGGCGCGGTGGCATCTTTCTCGGCTTTTGCTTGAGTGGAACGGGTCGACGATG
AACTCGAAGGCGCGGCTCAATCCTTCGGTAAGCTCAGTGAAAGGCGAGGACGACATGGTGCTGCTGTCGCGGTTGCGTTAGAGGCGGCGGAATGCGAAAT
GAAGGAGACTTCCGGCCACCCGGTCGGGCTAATGAGGATTACTACCATCGCGTCGGAGTTGATCGCCAAGGCTGCCATAATAAAAGATCATCTGCGTGAA
AATCAGGTTGGCTTGAAAGTGTTGATTGCCACAGCATGCTTGTCTCTCACCGCCAAGCACAATCCCATGATCTCTCCGATTCTCACACGTCACAATATAC
GAACAACCATGTTGGAACTTCATGCATCTGCCTTCCAGGGGTCTTCTATAGCCCAGGCACTAGCTTCAGGGAGCTGCCACTCTTGCATCGCCTTGTCTAA
AGCAGGAAACTGCGCTTTAATGGCATTTCGAATCTGCTCGTCCGCGATCTTGTGGCCATCGGCGTTTAGATGCAGACCATCCTCCAGGAGTAGCGCGTTT
CGTGTCGACTCAGGCATCGAGTTGAAGTATACATTCAAATCCAGCACTGGCACATCGAGAGCCCTACCAGCTTCAAGACACGCTCGAGAATATCTTCTTG
CGTTTGCATTCGAGTGGTCCACAAGGCCTCTCCTCGAGTCGTTCCGCTCTGCGGCATACTTGATTCTGGCAGTATCGTCGACATGGATCGGGGTGATCAG
CAGAATGCTCGCATCCGGGGCTGTCCGTTGAAAGCTGCTCACGATCTGGAGTAAATTCTCCTTGTAGTCCTCGATTGGGACGTGCAGCTCTGGGTTGCTT
CCGTCCCACAGCACGGCGTCGTTCGATCCGAGCCAAACGGTGACGAACGATGGAGACGTGTAGGCACCACAGTTGATTTCCTCTTGGATAGCAGGCATCG
CGTACTTGAGGAACCATTTGCTGTTGTAGCCCGAGAGCCCACGTGCGATGATGTCAGCTGAGCGTCTGTATCGAAATTGCAGCAGCGTAACCCATCCACC
TTTCCCCGGGTCGGTGGCTTTCTCAGTGAGCGAGTCGCCTGTCAGCAGCAGCACTGGGCGAGGCTTGGACGGTAATTGAGAGGCTTCCGACCTCACGGTG
TGTAAGAAGATTATGAAGAGAGCGAAGAAGCAATGGAGTGCACAGACAGAGAATGCCATTGGGTTGCTGACAAAGTCGATAAATGATCGGATACTCGACA
GCTCGGTGGAGGACGACGCTTTGACCGGGTTCCATGGGTCGCGCGAGGGCGCTTGGTATCTTGGATCTTGTCGAAGCAGATTGCTTGTTGGCATGGGTCT
CTCTCTTCCGGACACGGTCAGAGTTGCACATATGCAAGTCGCAGCGTACTGCAAACCAAAGCGTTTGCAAGAGTTCGCTGTGGAGTTGTTTCGCTCCAGA
CACGATTTCGTATTGGCGCGTATAGGTATTGCGTGATGCTGGAGCGATTTTTGCAATGCTGTTGTTTGCAGATCCTCAGAAAGGATACAACATCGCTAGT
GCTCAGCATCGAAAGCAGCGACATAAACCGACATCCGTATTCACGTGACGAAGTTGCTGCACCGCCCTAACGAAAGAGCTGGTACGCTTCACCGTGCACG
TATATGCTTGGCGTCCGTGTACCTGCGCGGCTGGTATGGGCGAATACAGTCAGCGCGGGCTTGTTGAAATTAACAAATGCCCGATCCGCCAGCAAACGCT
GATGTGGTGACTCTCACAATGACCAAACCAGGATCTGTGCCGTTGGTCCGGCTCGGCTCCCACTTTTCGTTGGTTTCGACGCTTACTCTGGTATTTGCTC
TGCATCGCTCAGGGTCTGAGTGTTAACCGTAAAAGAAGCATGCGTCTGCGACTCCAAGTATTGGCGGCCATCGCCACTCTGTTCGTGAGTGCCCACGCCG
CGAGCGACTCGGTTGCGGAGAAAACCTTCACAGTGGTTTCCCCCGACTCTAATGACACGCTAGAAGGCTTGTACGTCCAATCTGAAGGCCGCAAGTTCCT
CATTCTCTACGACGACTCGAACAAGACCGGGAGCGAAGAATCAGCGGAGCATTCAATCGTTGACGACGGCTCTTCGTACGAGGGTGAGACTTCGTCTGAT
GGCTCTGCCGACCAAGAAGAACGGGCGGGGGCAATTCGTGTAGGCACCGTCACGAAGAAGGTGAAGAAAGTGTTCCCGAAAAGTACAACACTCTCTGGAA
CAAGGCCCTGTACTACTTGTTCCAAAAGCTCACTCCGAAGAACCGCAGGATTCCACCTTCGTAACCCTCACGTGAACTGGAAGGTAGACTAGACCTGTAA
GCGAAGCTAATTCACGTATTGAATGCTTGGATCTTTCTCTAGTCCTTACAACAAATCACGGGGGTGACTCAACTTTTGTTTCACGAAACATGGAGACGAA
TGACAACTGCATATAACACGCCGCCGAAGGATGATTGTTGGTCCAGGGATGACGCCTAGGTGGTCTTCTCTGGCTAGGTTACGCAGGTTAGGCTTCGATA
CGCCCACTGCGCAGGGAACAGTATGGGTATCACAGCTAACGAGGTACTATTTGGCATCACCCCTCAACCGGCTCCGAGCTGTCGAAGACAGCCACGAAAA
CCTGGCATCGAGCCAACTGCGTAGGCCACAACCACATGCTCGTCGGGGACTTGTGACTCAAATGGGCCGACGAGCATGTGTCCGTCGTGTACAATCACCG
AACACGAACAACGAACTAGTGGGGGAGTGCTGGCATCGTCGCCTTACTCCGAAGAATCATAGATCAACGCCTCTGCGTACGCAAAGCTAACCTCGCTTAC
AAGCCTGAAGAGACTGGTGCTATTGAGTAGTATGATATCTCAGCCTGTAAGTTGTGCAACCGGTGGATCAATCGCCTGCCTGCGTAGTGTGGCTGGAGGA
TAGGAATCAAACCCAGCGACTGCTGAGGCGTCAAATCAACACAAGTACGCAGATTGACAAGGCTGCACAAGGAAACACTGGCCTTGAATCGGTCATCGAC
GCCCTTCTGGTTCGGCGACGGTGATTTACGCGCATAGACCGGTGGAGCTCCGTGCCAAGAGCGTGCTTGCCCGCGTCCAGGTCGGTATAGCGTGCGGAAA
TCCAGCAGCGTATGATATCCCAACTCGATGACGGCCGCTTGGCGATTGCCCGCGGAATAGCCCCCCGCCATCCGCCAGCGAGTCGTCTCAAAACAATATG
GTGGTCATTTCTGCCGCCGCCTCATAACTGAACCCACATCTCGTCGCCTGCTCCCATTGGCCCATATCCAACATGATTTCCACACGCAAGAGATCTCCCT
TCATTCCTGCTTCTGCCGTCTCGAGCTCAAGTGTCCTGCTTCTCCTCCTCACTCAGCCATGGACGGACTCAGCCGCGCGTTCCACTTCATCGTGGACCCG
TTCCAGAAGGAGCACAAGCCCGAGAAGGCGGCCACCGCGCCCTTCGACCAGCCCTTCCTCGAGCCCTCGCGCTGGTTCCTGACCCGGGAGGAGCTGAGCA
CGTCGCGCGACGGCTACGAGCGCAGCGGCATGCACGTGTACTCCAAGGGCAACCGCGTCAAGCTGTACGCCGCGTCCGCCGGCTACTTCAATGACGTGGC
CGACGACATGCTGGACGTGCGCCGCGGCGACCTCGTGTACCTCACGGGCTGGGGCACATGCAACGTGCCGTTCAAGCCCACGAGCCCGACACGAAGCTCT
GCGACCTGGCGGAGGCCGCTGTCAAGCGCGGCGCCGACTGGCGCATGCTCGTGTGGTCCAACGTCACGAGCGTGCGCAGAACCACGAGGTGCGCGACCTC
ATCAACGCGCTGCCGCCGCCGGAACAGTACGGACCTGCGCGCTTCGTGTACGACGACCGCCTGCCGCATGCCACATCGTCGCACCACCAGAAGTCGGTGA
TCGTGCGCAAGGGCCGCGACCTCGTGGCCTACGTGGGCGGCGTGGATCTGACCAACGACCGCTGGGACACGCTTGAGCACGACCAGGCCGAGCTGCGTGA
ACGCACGGGCATCAAGTGTCTGTGGAACGGCTGGCTGGACGCCCACGCAAAGATCGAGGGCCCTGCTACCAAGGACGTGGCCTGCAACTTCCTGGACCGA
TGGAACTCGGACGACAAGCCGTCGCAGGACCTCATGGACGACCTGCTTGACTTTGAGAACCCAGACTACTCGAAACTCCCGCAGATCGACGACTGTGACA
CAGCCCTCGACATCCCCGAGGACGGCACTCACGCCGTGCAGCTGTGCCGCACCTTCAGCCCGATACGACCACTACGGCTTCGCGCCGCAGGGCGAGCAGT
CCATCTTCCACGCACGCATCAAGGCGATCCGAACGCGCAGAACTACATCTTCATCCAGGACCAGTACTTCATTCTCGTGCCGGAGCTGCTGGAGGCCATC
ATGGACATGATGCCCAGCATCGAGCGCCTTATTGTCATTGTGCAGCGCACGGTGGAGGCCGGGTACACTGGTTACGCCAAGTACCTGTACGACATGGTAT
CTCCCATCCAGAAGGCGTACCCGGACAAGTTCAAGCTGTACTCGACCAAGGAGTCCAAGGAGCTGTACATCCACAGCAAGCTGGTGATCGTGGACGACGT
GTACGTGTCCCTGGGCTCGGCCAACTGGAACCGCCGCAGCATGACGAGCGACACGGAGATCGGCATCAACATCGTGGACACGGAGCTGGTGCAGTCTCCC
GACAACATCACGGTGAACAAGCTGGCGCGCAACTTCCGTATCCAGAAGTTCATGGAGGCCACCAAGCGCACGTACGACGAGCTGGACGCCATGACGTTCC
TGGAGGCGTGCGACGCGCTCGAGACGGCGGCGCACGACGATGGCTCCAGCCTTATCGAGCCGTACGCCGTGTCGGACAGCGCGGCCTTCGACTTTGTGCC
GGACGCTCTGCGCCAGATCGTGGACCCGGACGTCGAGGGCGACGACTGAGCGCGCCCCAGACTGTGACGTGGTGGATGATGTGTCTGTATAGCTTTGGCT
TTTAGTGCTTCCTCTCTCTTGTGTTGAGAGGATAGCCCAATCGTGTTCATCAGGTGCGATTGAGAGTAAAAAAGAATGAAAACACCGTTTGGATATGCAC
GTTGAAGGTGTTGAAGTGACGTTGTGCGTGGAATCGTTTGTGAAGACTTGTCAGGGATTTGCTTACTGCAGGACGACTACCAGAAGCGTTTGCTTTGTAT
CTTCCTTCTGGTGCGTCCTGGTCCGCGTGGAGATCGGAGCGCCAGCCTTCGAGTGCTTTTCCGGGGACCAACGGCCGATGAGAGCTGCTTTGGACTCCCC
ACTTCGCACCCTCCCCGGCGTGGCGCTAGCACCCACTTCTGCGCTCAGTCGCCCACAACGGCAACAAGGGCCAGTTCTTTGGCATCGGAGTTTATGGTGG
AGCCGCGAAGCTGTGGCGAGGGAGGCCGAGCCTCCGTTCGAATGAACCAGCTCCGTGCTAAGTGGTTGCTGACCATCTCGTCATGCGGCTTTCGACATCT
TCGTCCGGGACGTCACGGTAATCACCAAACTGCTGCTAAACTTCGCAGTGTAAACACCGCGCTGAGCTATAGTTGGTGTTTCTCGGTGGCTTCTTCATCT
CGCCCTAGTTTTTCTGGCCATTTCGTGTGGTCTGGATCGAGGGCCTACGTGGGGTGACGTCAAAGCGGGGGATCAGAAATTCACGCGCCGAATCGCGGAG
CCACCGACGATGGGTCCATTTCACCCGGGATTTACGCTCTACTGAATTGATTTCAGCGGAGTTCAGTTTAGCTCTGGAAGCTCCGATCTTATCTATAGCG
TAATACTTGGTCGCTGTCCTCCCTTAGACTTTACCCTTCCGGCAAGAGCTCGTCAAGGGTTCTCGAACTGTTGGTAAGACTTGGCGCTAGTTGAATCCGG
CCACTTCAACCAGTGAACGAGGTGGCGGAGTCATTTCTACCGTTTCGCATTCTTGCGTCTCCGCTCAATCGCTAAGCGCTCTGCAGGACTCTTCCGGCAT
GAGCTCAGTGATGACTCGGTCGCCTGTCCTTAGGGGCCTAGCACTGAACTAATTGCAGGGAAACGCGAGGGCTTTCACCGCTCGTCTTCCCGTTGAAACG
CTGGGGAGGTTGGTCAATCCTCGCAGCTTGGTTTCAAGGTCGGCTTGGTTGGAGCGCTGCTGTGGTAATTTAACTGCAGACCCATTCTCTTTCGCATGCG
TTACATGACGCACTGGTCTTTCGGTTCCCGTTGTGAGCAGCACCGGCATGCATGAGGCAGGGGGTGGAAGATCACCGGCTGCTGACCTCATCCCAGCTTC
CCGGGCTTGCAGCGTCGACTTTCTTCGTTTCTTTCTCGCTCACTTTCAAGTTGGCGTCGTTTCGAGTACCCCCAAAAAATAACCTGCCCCACCTCGACAC
TACTGCTGGGCACCATGATTGACAGCACCCCCAAGGAGCTCGAAGCCGGCAACTATGACAACCAAACGTCACCGACTTTCAAAGGAGACCGCAAGTCCAT
CGTCGGCGCTTCGATCCCTCAGCTGCTCCTGATCTCCATGCCTCGCATGGCTGTCCGGATGGCGTGGTCAGCTCAGTGGGCCGCACTTGGACCTTACCTT
GGTACCATGATGCCCAAGTACGCCGTGCAACTCGCCCAGATCATCGGCCCTGTTACCGGCATCCTCGTGGCCCCTGTCGTTGGTGCTTTCAGCGATCGCA
GCACGAATAATGGGGTCGACGTCGACCGTTCCTACTGTACGGTGCCGTCACCAGCGCCATTTGCTGGACTGCCATGGGCTACACCCGTCAGATCGGAGAC
GTGTTCGGCGACACCGGTAGCGGCAAGAAAGGCGAAGAGACCAACCGATTCTGGACCATCTTCTTTACCATTTTCTTCTACGCGTGGATGGACATCACGG
TGAACGTTGTGCAGACGCCACTGAACCTCATGATCGCCGACTTCGCCGGTGAACGGCAGACCCTTGGTGCTGCTCTTGGCCAGGGATGGTCCGCGCTGGG
GTCTGTCATGGTTTCCGGGTATATCTACCTGTTTGGAGCGGCTCACCTGTCGTTGCGCTGGTTTCTCTTTATGCTCTCGGCCGTGATGGTCTTCACCGTT
TCAGTCGCATGCTTCTTCAGCCAGGAGAGGCCACGAGAGAAACTCGATCAAGTGACCGAGTCCGCTTGGCTGAGCGTCAAGGGTGCCTTCGAATCCATCT
ACCACGGCTTCAAGAGTCTACCACTCGAGCTGCTCAAGTACTCCGTCGTGGTCTTCTGTGTCATGTACGGCTTCTCCGCCTACAACGGCAACAAAGGCCA
GTATTTCGGCATCGAGGTCTACGGTGGAAGCCCGAAAGGCGCCAACATTTGTGCGCCTGATTGCTCTGATGCCCAAGACGCGTACAACCGTGGGGTTCGT
GTTGCTGGGGGATACGCAGACCTATGGTTTAGTCTAGTAGGCTACGCCTACTCGTGGGTGTTGCCGTGGCTTGTGAAGCGATTCGGCGCCAAGTGGGTGC
TCTCAGTCGCGCTGATCCCTCAGTCCTTGCTCATGGCTATGGCTTTCACCACCACAGTATCAATCGACGTCACGATCGTTATCCTCACCACAGTCACGCT
GACCACGGTATTCGCGCTCAACGTGCCCGTGATCATTCACGTACTAGGGCACGAGGCTGAGATCGGTGTTTATGTTGGAGTGCTCAACGCAGCCAATTGT
TCGGACAACTTGTTAACTTCTCCATCGGTGCTGCAGTAGTTGGTACGCCTATGGGGTACAAGCTGCCGGTCTTCCTTGGTGGGGCCACGAGCTTCCTCGG
TATGCTCTTCACTATTTTCCTGCTCAAGATCAAAATGTTTTCCTTGTAAATTGCTGCTGCAGGTCATGGTTTGAAGACAAAACAAATACTTCACGTAGCA
AACGTAAAACAATAGCCGCCTTGCATTCTTCTGTGTGAAAATTAATGAGCACCTCGAACTACGGTAGGTAAGCTTAGAAAAGGAATGAAGAACTAAATAC
TACTTCCAAGTACGTCTCGAGCGCTATCGTGGCAGTGTGCCACCGCGGGTTTACACTAGGCAATACTGTACAAGTGCAAAAGCTCAGTTTTCAACTGTAC
TCTAAAGAGTACCACGTCCGTGTGAAAGGGAAATATGTTGCTATTTTATAAGGCGTCGACTGCGACGCTCACTGCACGCTGAACAATATCTGAAAACGAA
ATGGACTAGATGGCGTGGAAGGGTGCTACCGCTTCCGTCTGGTGGTCACAGCTTACATGGAGTACATCTTCATCTTGAAGAAGAGCAGGGCCGTAATGAA
GCCGAGTGCGCTCATGACACCGCCAAGGAAGACGGGCAGCTTGTAGCCGAGAGAAGTTTCGACCAGCCCGGATCCGATAGCGAAGTTCAGCAACTGTCCG
AAGCAGTTCGCCGAGTTGAGAGCTCCAACGTAGATCCCGATCTCCTCGTCTTCGCCGAAGACGTGGATGATCACCGGCACAATGAGCGCGAACCACACTG
CCTGCGTGATGCTGGTGATCGCCACGACGAAGACGTTGAAAGTCACGCTGCTCGTCCAGGCCATGATCATCAGGAAACTCTGCGGGATGGTCGAGATCGT
CAACACCCACTTCACGCCAAACTTGTGCACCAGGAACGGAATCGTCCACGAGTAGATGTAGCCGACGATGTTGAACAGCAAATCAGCGCGGCCACCGGCG
ATGCTGACGCCGTGGTTGTAAGCGTCCTGCTCCGGGGTGCACGGGTCACAGGTGTCGGCGTTCTCGGCCGAGCCGTTGTACACCTCAAAGCCGAAGAACT
GGCCCTTGTTGCCATTGTACGCCGTGTAGCCGTACTGGACGAAGAAGAAGCAGACGCCGTAAATGGCAAGCACACCGGGGAGCGTGCGAACGCCATGGTA
CACGGAAGCGAAGGCGTGGGCTATGCGCTTCCAGGTCGACACGGCGTCGACCTTGCTGGGGTCCAGAGGAGTCTCCTTGCCGAAAATCACAGCAACACTA
ATGCAGATGAGCATCGTACCCGACAGCATCCACATGAACTCGTGGAGAGTCTTGTGAGCCGCGCCGAAGAACTCAATGTAGCCGGCGACAAGAATCGAGC
CCAGAGTCGACCAGGCCTGGCCCAGAGCAGCACCGGTGGTTTGGCGATCACCGGCAAAGTCAGCAACGAGCAGCATAGCCGGCGTTTGCACGACGTTGAC
GGTGATGTCCATCCAGAGGTAGAAGAACACGGTGAGGATCGACGTCCAAGAGCGGTCGGTCTTCTCGCCGTCTGCGCCGTCGCCGTGGTCACCAAGAGCT
TCACCCATGTCGCGAGTGTAGCTCATGGCAATCCAGCAGATAATGCTGAGGACGCCAGCAACAACCAGGAAAGGTCTGCGACGACCGAACTTCGAAGTGC
TGCGGTCACTGAGAACGCCGATGCTGGGGCCGACCAGCACACCGACGATGGGGCCGATGAACTGCGTGATCTGCACAGCAAAGTTGGGCAGCATCGTCGA
CAGGTACGGGCCCAGAGCAGCCCACTGAGCCGACCACGCCATGTTGATGGCCATTCGCGGCATTGAGACCGCGAGCAGCAACCAGATTGGCGGGTGAGAG
AGCGGAGTCTGCTCACCGCCGTCTTTGCCAGGCTTGGGAGAGCCTTGAAGTTCGTAGCCTTTCTCGACGTCCGCCATCTTGGAGTGGAGCTGGAACCTTG
GAGTGGTGTGGGCTCAAGAGCGCAAGTTGTAGAATGAGAAAGACCGAGAAGACCGTGCGGTGGTGCTTTGAGTGGATAAACACACCCTTGACGTTGCTGG
TTATCTCCACCAGCCCGTACGGTAACCATCCGCTGCAGGCGAAAAAACAGCCATCCCGAGTCCCAGCCGCACGAGCAGCGACCCACAAAGTGCAAAGCTT
CTGCTATTGTGCTTGAGCAGATGGGGAGCGGCTGGTGACTTTGTGACTTTTACACTGCAGTAGATCACCACTCAGTTGAGCTGCTTCCCAAGACAAACGA
CTTGCAAGAAGCTTCAGGCGGCGTGTTTGGTGGGGTGTTTACCAAATTCAAAGCACCAGAATGTTTCTATTAGACATGGTGACCAAGGCTCGTTTTACTG
CACCTTGAACCGCGGCTTCGTTTCGTTGACAAAGCGTCCTTGAACTTGTATTTGCTGAAAGGAACTCCCAGCTGATTTGTCTATTTGCGCCTCCTCTGCC
AACAGTGCGCGGTGCTGTGCCAGCACCGCGGTCAAAAGCTGGCACAGATTGGGTCGCTTGTGGTAAAGTTAGTATGCGTCGCACCAAGATCCTAGTGGTA
ATGAGGGCGTCAGTTAGTATTAATATGGGCCGCATCAAGATCCTAGGTTGAGAGGTTGCACAGACCGCGAGTGCATGTATGTATAATGCATGCATTTCGC
ATGAATGCAAGTTTTGCTAACTTAGTTGATCGATGAAGGTGTCGCCATTTACTTGCCAAACAAACGATGCTCACGTGTGTCATCTGATTCGTCCTGTTGC
TGCAGATTAAAAATCGTGGTGCCACATTGAAGTGAGACCCTGGGCTATGCTCGTTAGTCCGCAGCTGAATTGTCGATTCCAGCGTTGTGGGCGAGCAGAA
ACTGGATTCACGCGTGCTCTCGCCCTCTTGAGCAAGCAACTTCAAGCTCTGTTCCCGCCAGCTCTTTAGCTTAAGAACACCCGACAATAAGAACGGTGCA
AACTGAACTACAGTTGTAATGCTGGGCGATTATGCCATGCTCCAGTTCTTTCGCGGTGCTGGAGCTGGTCGAAAACTTCAACGGCAATACAGCCTACCGA
AACCACGCATCATTGATGTGGGTAGTCGATTAAAGCATCACCCGCAAGTTTACTCCGTCGTCTGGTTATCTACACTTACTGCCCTTCAATTCGGCTCGCA
TACACGTGTGCATGTATGCGCTCCTCTGCATCAATATCATGGTTTCGATACGCATCCACTATACAGTCCACTACTACATGCTGTACATTTTCATCTTGTA
GAAAATCAAAATGGTCAGGAAGCCCAGGAAGCTGGCGATACCTCCGACGAACACCGGCAGCTTGTATCCGAGGGACGTTTGCACTAGCCCCGTGCCAATG
GCAAAGTTGAGCAATTGGCCAAAGCAGTTTGCAGAGTTTAGAGCCCCAACGAACACGCCTATCTCTTCGTCCTCCCCAAAGACATGGATAATCACTGGAA
CGACGAGCGCGAACCACACGGCGTGCGTGATGCCGGTCGTGGCAACGACAAAGACGTCGAACCCAGGGCTGCTGACCCACGCCATGGCCGAGTAAAGGAT
TTGAGGCACCGTTGAAATGGTGAGGACCCACTTCACGCCAATCTTGTGCACCAGGAACGGCATGGCCCAAGCGCACACGTACCCCACGACGTTGTAAAGG
AGGTCTGCTCGGCCGCCAGCAACGCTAACGCCGTGGTTGTAAGCATCCTGTTCAGCACTGCATGGGTCACAACTGTCTGCGTTTTCAGACTCTCCGCCGT
ATACCTCAAGCCCGAAGAATTGGCCCTTGTTGCCGTTGTACGACGTGTAGCCATACTGCGTGAAGAAGAAGGCGACCCAGTACACTGCAAGGACACCAGG
AAGGGTGCGGATCCCGTGATACACCGCAGCGAATGCGTGCTTCACCCGTGAACACGACGACGCTGCTTCCACATCATTCGGAGATAGCGGTGTTTCCTTC
GCGAATACCACAGCGACACTGACGCAGATGAACATGGTCACGGACAGCATTCCCATGAACCAGTGTAGCGTCTTGTAAGCAGCCCCGAAAAACTCAATGT
AGCCTGCAATCAAAATCGCACCCAACGTCGCCCATGCCTGACCAAGAGCTGCGCCCGTAGTCTGGCGGTCTCCTGCAAAATCAGCGACCAGAAGCATGGC
CGGGGTTTGAACGATGTTCACGGTGATGTCCATCCAGAGGTAGAAAAATACAGTTAGGATTGACGTCCACGTGCGATCGGTCTCGTCGCCGTCAGTGCCG
TCGCCGTGGTCACCCAAGGCTTCGCCCATTTCACGCGTGTATCCCATGGCAATCCAGCAAACGATACTGAGTACTCCAGCCACGATCAGGAACGGTCGAC
GTCGACCCATTTTCATGGTACTGCGGTCACTGAAGACGCCCACACTTGGGGCCACGAAGACACCAGCGATAGGACCGATGAACTGAGTAATTTGCACAGC
AAACCGCGGGAGCATCGTCGACAGGTAGGGGCCGAGTGCCGCCCATTGCGCCGCCCAGGCCATTTGAATTGCCATCCGAGGCATGGAGATGGCCAAGAGC
AGCCAAAGTGACGGGTGAGACTGACCGCCATCTTGAACACTGCCGGGCTTGGGCGAAGTGTGGA