Description :
From Genome Similarity Track
Location :
Scaffold_1129:11736- 13372
Transcript NameFunction/comments
Phypl_g12501transmembrane protein

Sequence
1636 bases(100 bases per row)
AGCGCTTCTCGAACACGAGTCTGCCGTCCAAGACCGAGGACTACCATGAAGTGAAGACGCCCAACGTCGGAGAACTCGAAGACGGAGCCATTCGCCCGGG
AGGCCCGCCCAACCTGTACAGCTGGAGCAACATCGGACTGATGGCGCAGTacgctgccgtcggcgtGGTCTACGGCACCATGTACAGCGTCATCTACCCC
TTCCTGACCAACTACCTCCGCATGTCCGGCAATGAGACGACGTCCGCAAGTGTCTTGATCACGCTGCCCTACACGCTCAATGTGTTCATCGGCATCGTGA
CGGACCTCTACCCGATCTTCGGCTTCCGACGTCGCCCGTACATGCTCATCGGCTGGACCGTGTGCTTCGTGTCGCTGATCGTTATGGCCGTCATGCCTAT
TGGCGACCCGTACTACCCGGACTCGAGCTGGGCAGCACTTACCACCCTCACGGCCGAGCAGACCGCACAGCTCAACACTGGCGCGCAACACTCGGGTGTT
AAGTACATTTTCCTCATGGTGATCGCCAACTTgggcagcgtcgtggcgttCACGGCTTCGGATGGCATCCCCGTGGAGCTCGCTCAGCGAGAACCTTTGA
AAACCCGTGGGGCCCTGCAGGCCATTGTGTACGCGGTGCAGTACTCGTTCCAGATCATTTCGTCGGCGATGATCGGCTTCGGACTCAACAGCGCCGACTA
CGGCGGTACCTTCTCCGGTTCCATGGGCGTCAACGCCGTCATGGGCGTGTGCGCTGCCTTCTCGCTCGTTGTGATGCCCTTCTCGTGGTTCTGCGTcacg
gaggagaagacgcaCCGGCGCTCGGCGAGGAAGTACCTGTACGCGTTGTACGAGCTGATCCAGCAACGCGTCGTGTACCAGATCGTCATCTTCCGTTTCT
GCCGCAATGTGTTCTCGTACGTGTCCGTGACGGCGTCAAGCCTGATTCAAAGTTACTGGTTGACGGTGAGTCCCGtgaacagcagcgtggcTTCAATCAT
CGGCTTGGTAGTCTCGGCCGGCTCGCTGTATCTGACGAAGCAGTTCGGGCTCAACTGGAACTGGCGATACATGATCGCCATCTCTCAGATCGCCGTGATC
ATCATCGATGCCTTCcccaccttcttcaccatTTGGGACGTCTACCGTAGTCAATGGTTCTGGCTTGGCGTCCCCCTTGTGGAGAATTTCCCCAGTGCGA
TTGGAACAATCGTCGCGACGTTCGCGGTCCTGGAGATCATCGAGGAGGGCAACGAAGCCACAGTGTACGGGCTTATCACCGCCGTGTCCACATTGGCATC
TCCGTTCGCCAGCGTCATCACCAAGAGTATTGACAGCCACTTCGACGTCGAAACAGAGTACATCCGGCTGGACAACTCGTACGTCCGCTGGCAGGTGACG
TACACATACCTGATCGCCTACGCGTTCAAGCTGAGCTCGCTCGCgttcctggtgctgctgcccaagcaaAAGATTgagacgcaggagctcaagcgcacaG
GTGGCAAGAACAAGTGGATCGGCATCGGTACAATCATCATCGTCGCATTCTCGCTCGTCTGGTCCGTTATGACCAACCTCATGACCATGTTTGACAGCAC
GTCCTGCCTGCGCATTGCAGGCGGAACCGGGTGCTA