Description :
From Genome Similarity Track
Location :
Scaffold_139:117348- 120507
Transcript NameFunction/comments
Physo_159344PsAvh427

Sequence
3159 bases(100 bases per row)
ATGCCTTCGCGCGTCATCATTTAGCCAGGCCGAGTCGCGGAAGCAATACAGATCCGAGTACGTCAGGTCGAATCCGAAGCCACGCAGTTCATTGCACGGC
CAGTTCTCCAATAGCTCGGTAAATGCACCGGCACACGGAAAGGGAGGGGCATGAGCAGCTCTTACCTCGCGGCGAAGCCACGAGCAACAAATTCACAGGT
CGAAGACCTGTGCTTGGCCCCGGCAAAAAACTTGTAACTTCCCAAAACCGGGAACCAAATCGGGTATCTCTTTCTTAATTGTAATGTTTAAGCTAATATC
TGCCGGAATCGGGTACCCGTCGATAAATGCTAAGATTTATGCACATTATTTACCAAAGGTTGATACTAATCGTTTATTATTTACCAAAACCTGCATTAAA
ACACTTGCGGACCTAATGGCTTCACTGAAGGCGTATCCATTTGCGCCATAATGGACCAAGCTTAGCTGAAGATGACCAACGTGACTTGTCTAGGTGCAGG
CTGCACTTTTTACATGTCCATTTGCTCAATACCCAATCACTCTTAGCCGAAGATGCCCAACCTCGTGTCTGTCGCCAAACCAATCAGCTCAACTCGACAG
TGACACGAGCATCGTTCGTTTGAATAAGACTTTTTTCCCTGCGTTGAAGCATCCACTTCCAAGGAATTGGCCCATTAGCGTATTTATCATTCCGCAATTT
ACTCCCCAAGCCCTCAAGTTAAAAGTTTGTTTGTTTGTTTTGTTTTTGAATTGAGGATCATTATTGTCACTTAGCTAACATCCTCAAGTTAAAAAAGGGC
CAAGATCAGCGCACCATGCCTCTCTCCTTCGTTCCGCTACTGTTGCTCTCTCGTCTTATCGTTAGCACACAACATTGTACAAAAATGAGCACTGCAAAAT
GAATGAAATAGCTCTCTCGTTGCTGGTGCCAACGCAGCCATTGGACGCTGACCAGGGTGTTATGTCACCGACAGCGTTGCGTCAATTTACATTGAAAAAA
TGATTGAGATTTGTCGTCACGCTACAATTTTAATTGTACAATGTAGGCATTGAATTGTATTCTTGTGGTTTGTATAGGGGTCTGTATGGACCATTTGATT
GGCTACCCACGCATACAGTTATCAAGTCAACTGTCTTGTACAATACAATAAAATCATTGCAGCCAATTTTCTAATTGTAATTGTTGACCCCAATGCTATC
AATAGTTTTATTGCAAATTTTATTTACGCAAAGCTGGTCACCGATGGCCTCATCAGACCAGGCAACCTCAATTGGTGACTTTCGGTTCCTGAGAACCCAC
CACGATAAAGAAGAGCGGGGCTTGTTGGTTACCAGCCTCACAAATGTTTGGCTGAAACATCATTTCCGTATCGATACATTTCGATGTGCGCAACTAGTTG
TTCAATTACGCATTCTCGGGCAGATGCTGCGGCTGCGAAGCAGACGCAGTAGATGCCCACGTTAGAATCAACTAGAGAGTTGGGCTGGTAGTGCTTTCAA
GGATTAAAACAAAACAACTTTACGATTGACTAAACTATTATCCGTCCATGAAACTATTCGTCGATCTGTGTACCCTCCCGGAGCAACGCTCCGGGTTGCC
TATTAAAGCATCACGACATGTAGCTTGTAGGTTCCACAACCAATTTATCGACTCCACTTGGTCACGCCTGAACTGGCCGACCTTAGCAATAGCCGCCACG
TAACAATCGCCGCCTGCAGCGGCTTCGCCCTCACTGTCTAGCTCGATCTGTTCGTTCTTCGCAAGGCCGCCGAGAAGTTGCTCCAGCGCGCTGTCAACTA
CAGACTCCAGTAGACGAAACTGGACTGTGTCTGGGACGAATTCAGCGTCGACGCGCCACTCAATGGGTGTGCCTTGCCCGTGAGACTTTACTTGCAACGT
AGCCAGGAAGGACCCTGTCTCACGAACACCGGGTTTAACATCGTGAAGTGTAGCCACCACTTCACACACATCTTTTTCGCGTAATAAAGCCCGTAGGTTT
GTGCCATTGTTGTACTCCTTCAAAGCCTTTTTTGCCTTTTCCTTCTGCGCTGCACGGTCGAGAGGGGGGCTGCCTTGCCGTCTGACATTGCCTGACAGTC
GAACGCTTAGCCCGCGTGAACAACCTTCATTATCGGCAGCTTGGGTTGTCGAATCGACGACCTGCGTCGGTGCCTCATCGTCAGATCCGTCTTCGTCCTG
CATGTTCCCTTCTTCGGCATTGCCATCGTGATGATCTTCTTGCGGGCCCTCTCCCTGGGACGCACTCCCACCCGGAGCGCCACCATCGTTCCCACCACCA
CCACCACCACCACTGCCTGAGCCATCGTCACCAGAGGATGGGGTCGACAAGAGATCCGTCTTACCATGCCTCAGATTGTACCACCACTTGTCAAGGTCGC
TCATAGCAGACTCAAACACTTCGTCCGGAACCTGCGCGAGCTCTCCACTGATACGGCCGAATGCCTGCTGTGCTCGACGATACTTTTCCGCCTCTGTGGT
GTAGAGAACACCAGATTTCGCGCGACCAACTCGGCTGGAGTGGTACACTGTACCGGTAGCCGAGCTCAGCCGAGCTCAGCAGCTTATCCGGACACCTTAT
CCGGCTCAGCCGAGCTCGAAGAATTATCCGGATAGTTCATCCGGACCAGCCGAGCTCAAGCGTTGCCGAGCTCAGCGAAGAGTCGGCCGAGATCCAAAAC
CGCCCACTTTCATTTGGTATTTGTATAGGAGCTTAGGAATAGTGGAGGTGCCCCTTCAGGGCGCCCGACAGAGATAACAAACAACAGAGCAGAATTTTCT
AGGCCTAAAGCACGTGTACACGTTCCGGTAAGTCCCTGCACGGGGCCGGGTTATGTCTGCTGCCGGTACCCGAGATGCATAGCTTGTAGGGTACTCGGCT
GGCAGCGCCAAGAGATTAAGGTCGGCCCGGGTTGGGCGCGAGTCTCGCCAAGCGCGAAGGAAAGTCTCGCCACCGCTGCGAGCCGGTGTTCCCGTACGTC
CCGGGCACTGATTGCTGAGTCGAGAAGCCTTTGCTCTCGGCGACCTGTAAAAGCGCTCCGTGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGA
GTGAACGGAGGCCGTCGAACTTGGCGGTTCTCCGAAGGAGTGATCTTGGTTGGCAGGTC