Description :
From Genome Similarity Track
Location :
Scaffold_11:117347- 118773
Transcript NameFunction/comments
g4044.t1hypothetical protein

Sequence
1426 bases(100 bases per row)
CTGTGGCAGCTTACTTGGCGTGCACGCAATTTGGTAGAGCTGTTCAAGCCGTTCACAGAGAATCAATGGATTTTCGTCGCTGATGCTGCAGAGAAGACGC
TGAAGCCTTGGGCAACGAAAGACTTTTGGATTGATTCGCATGAAATTGCGTGGGAGCGGTATGTGGTCAACTACTGTGTCGGGTTGAAAAAGTATATGCT
GCACGAGGATGTAATTGACGTGGACATCGAGGGCGTCAACCAAACCAAGCTCGCGCTGAGCACGGGGCGCATTCTGGACTGGGACCCTGACCACCACGCT
ATCTCGTTTCCTGGACTACTGTCCGATGTGGCCTGGGCGTACACGTCCAGTCGCAAGCCTGGGTACACCAAATCCGGACTGCTGGGTCGCGTGATGGGGA
TTACTGGGTGGAAGGAAGGCATGAATCACGAGGCATCGCACGTCCCCAGGCCTCATGTTGAGTCGATCGGCGGCCTTCGGAACAGCGTTCTTGAATCGGA
AGCTGTCCGCGCGGCCATCGAAGAACGCGCTGTGGCACAGGGAATGGATCTGGACGACGTGGAGCGTCAGGCCGCCAGCATGCTGAGCACCATGGCTGCG
CAGATGGACTACAAGGCAGTGCGTAAAATCGGCTGGCTGCTGCGAAAGGTGTGCCGCAACATGTACGACCAAATTCACGTTGACGAGTCTGGTCTCACTC
GTATTCGCGACTTGCTGGCTGATCGACGTGGGAGTGTCGTGCTTGTGCCCACGCACCGGTCTTATGTCGACTTCCTGCTGATGAGCTACGTGTTTTTCGC
CTACAACATCCCCGTTCCTTACGTTGCAGCCGGCGAAGACTTCCTTAACATGGGCAGTCTCACCAAGCTTCTGCGTGAGTCGGGTGCGTACTTCATCCGC
CGATCTTTCTCGGATGATCCGCTCTACTCTGCTGTCTTCCGCGCCTACACACAGTACTTGGTCTCCCAAGGCCACACGATCGAGTTCTTCATCGAAGGCT
CTCGCAGTCGTAGCGGCAAGCAGCTGCACCCGAAATTCGGCATCCTCAACACAGTCGTCGACTGTTACCTCTCCGAGAAAGTCAAGAACGTAAGTACCTT
CAGCTCCCAGCACAGGCTGCAATTCGATATCGGCGAGATGCATGACTGATTGTTGTGTGGATTTGTCTCCCAGCTCTACATTGTGCCCGTCACGATCGAC
TACGAGAAGCCGTTAGAAGTGCTGCTCCACCAGAACGAGCTCCTGGGCGAGGGCAAGATTCGTGAGGTAAGAGATCTCTGTGTCATCTTTCATTGCTGCG
TACTCATAACGCGCTGGTGGTTATGGTTTCTAGTCGATCAGCGCTCTGGTGAAGGCCATGCCCGTTGTGCGCAAGAAATTCGGCTCCATCTCGGTCAAGT
TCGGCGTGCCTCTGGATATAAAACAG