Description :
From Genome Similarity Track
Location :
contig_59:117311- 118314
Sequence
1003 bases(100 bases per row)
GTACAGAGTCAACATGAAGGTGATCCGGACGGACGGCGGTGGCGAGTTCCAAGGCCGCGAATTCATCGCATTTCTAAAATGCCACGGAATTCGGTAGCAG
GTGATGCGCCCAGACACTTCAGCATCCAATAACAAGGTGGGACGGATGCACAGGACGCTCATGAATGCTGGTCGTGCTATGTTGTGAGCTTCCAAACTGC
CGGAGCGATACTAGGACGATACAGCAAAATATGCCTCCATATCTGGAAACACATTCTAGCGAGAGGGAAATGTCGATTACAAGACGCCACTGCATGCCCT
CACGGGTAAGCCGCCGCGGGTGGGGTGCATTCTGAAATTTGGTTTGCGATGCACGATGCATGTAGCTCACAAGACTGGAGTCTCAGTGAAGAAACGAGCG
GAGAAAGGAGCCATCATCGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTGCACGTTTTTCGATGATCTCGGCGAATATCC
CTCGCAATAAATTAAGCTCCCCTCGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAACAAAAGCACAGTTAGCTAGCATATAGCAGTG
AACACACAATTCGATAAACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCGAAGTAGAGCACAGATGCGTGTGGGAAGCCG
ACAGTGGCTCCTGCAAGTTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGGCGAGGGCTCGTACCACTGGTATAGCGACCG
CTTCGTTAAACACCAGTTTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGTTGGTAGCAGGGTTAGAGTTTCTCCATATGC
ACAGCTTCCCGCTGACCCTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACACTCTCAGTTTGGACTGCAACGTATTCTTCA
TTG