Description :
From Genome Similarity Track
Location :
Scaffold_79:117301- 120153
Transcript NameFunction/comments
Phyca_LT1534511228calcium/calmodulindependent protein kinase kinase pu
Phyca_LT1534555874AlNc14C143G7322

Sequence
2852 bases(100 bases per row)
catccggtatgggtctttcggatgctgacagcgattcggacgattcggattactcggatgtggagtgcgatgtggacgttgatgccactttcagcgagct
gattgcctcgcctgaccagcttgaactgattagccacgacgacgaagaaatcgcgcctatcgtgacccacaggtcttccttgacgtcgttaaccgacttc
tcagatgtggataacagtggcaagatgctcactcttggctcgttgcattcgatgacttccagtacttcgacgttggatatcgtccaagtatacgtgagca
gtaagattcgagaaaatctcacactgtctatccgatccggatacgcagaggcgaagggagcacgctcgtacatggaagaccgcactacagggcagacaac
ttgcgacctgtcgcgttatccggatgcgctcgcaaccaactacgcgtccctggccttcttcgctgtttacgacggacacaacggcactgatacggctgtg
aaactacagaatgagctgcatcatcgattcttcgctgaaggcgctggcttcgtggagtccccagtgacttgcatttcttcggtatgtgaggcgattgata
acgagattttggagaagcagaaccagagcgtcatgccgaaacgtaagcgcacaatggctgcagacgaattgcgacggtacctccaagctgaagccaacaa
ttctaacctcattgaaggtgaatgctgcgagattgacggggagattgtatgtggtgacgagatgaaggcgctgttgcagccaatttcgttctctggggct
gcgagtgtcttcgttgtggtaacgaagcagcgcaagaaacgtcggcgcacgaatggagacggagacagtgaagctgaagaagccaaggaaggggaggaag
aagaggaccagccaacgctgctttacgtggcaaacgtcggcgattgccgcgctgttttgtgcactggcgacgcgcaggcagtggatttgacgacggatca
caaggcgtctttaccagcggaacaagcacgtattgaggcttctggtggtttcgtgcacaatggacgtctggatggaattctgcagatctctcgtggcttt
ggcgatcttgcacacaagcaggatggtcatctggtagtgacacccgacgttgtggagcacctcgtggacccttcggaccagttcttgctgcttgcaagtg
acggactctttgatgttctcacttcgcaacaggccgtcaactttgtgctgcggaagctccagacccacggggacgtacagctcgcagcgcaggagctcgt
gctcaagacccaggcgtactttgcccacgacaacgtcagtgtggtcatcgtggcgctgaatcagaaaaacgatgcgtgaaatggacgtcggcctcgctca
gacactagcgaagaagaccgacgaccgacgaagaagcagaaagaccaggaacgcaaaattgagttggagtaagtctgcagctgaagcctcaacgtccagt
cttccgatggaccagagggaggttgaaggcttcgtgctgcgactgtgaattagtatactttgataatgatcccgtagtgttaccttgtgactatggttac
ttggtgcttgcctcttcccactgctcgaactcgtcccaggagcgcagttcgtcctgctcctccagcacaaacacaggagacggcaagtccatggacgaca
tgtcgagatcgaactccacctcgtcgtccgagtctgcacaggcggcgtccagttcgtcaatagtcatgagcgttgtggcattgtccggccgcgtctccat
cattgtcatgtcgctcaataggaacggaactgctccaccgccaaacgtccctggagcgtctctaaacggctcacgttcgagtgtgaggaacgtgcgtagc
tgcacggcgaaccccagagccactaacggacagcgacgtgtagacggactcgtagcgagcgtcagaagtccctgaaggtacttgaaaaactgctctgcac
gctgttgaacgaccttcgggctcttggagccccatagctttcgtttggggaagtatttagagctcaatttgtccagagcttccatcatcggcgcgcagtg
ctgacagtgcgcgtgtttgttgtcatcagccgctcctgggtggttccgccgatcaaaaactcgtgccagttcctcccgcaatgacctgaaacctgaatat
cgtctcgagacgaaccaccgctcgcctacgctcgagaccatcgtgtcttccagcaccagctcatactccgtgtgtgtaccgggtgacaccatcgacgtgt
actgcaaaatcgacgattctttcggcgtgaccgaatgcagcacgaagcctcctaagtggttggctaagctacgcggccgcttcttactggacttgagcga
cgacagcgtggacgatgtggacttggacgatgtggacgtcgagcgcggcagcgaccgacaactgctcgacttgtggctgtcgtcgctacgactgcgtccg
agcgccacactggatggatagcgacgcatggagtcgagcaagacgctcgagcggacgctggtgcgacgtcggtcgttggccgtcgactcttccacaggtt
tgttgacgtgtcgagagctcgagttctccgaggaggaggtggacgaagacggggagtccaagaagaaggacatgacggactcagacacgggcatgggcgg
tgggcgccgcagcttgggcggcttgtgcttctcctccattgctggcgagttcgggtatggcgaaatgctcgtgacaaggggggaacatgtggtcccgcgg
accaggttgcgggatccgtacgcgactggcgcatcctcctgggtcacagagt