Description :
From Genome Similarity Track
Location :
contig_59:117281- 122373
Transcript NameFunction/comments
g8978.t1hypothetical protein

Sequence
5092 bases(100 bases per row)
GATGCAGTTTGCACCAAAGTTTCGACAGCAGTACAGAGTCAACATGAAGGTGATCCGGACGGACGGCGGTGGCGAGTTCCAAGGCCGCGAATTCATCGCA
TTTCTAAAATGCCACGGAATTCGGTAGCAGGTGATGCGCCCAGACACTTCAGCATCCAATAACAAGGTGGGACGGATGCACAGGACGCTCATGAATGCTG
GTCGTGCTATGTTGTGAGCTTCCAAACTGCCGGAGCGATACTAGGACGATACAGCAAAATATGCCTCCATATCTGGAAACACATTCTAGCGAGAGGGAAA
TGTCGATTACAAGACGCCACTGCATGCCCTCACGGGTAAGCCGCCGCGGGTGGGGTGCATTCTGAAATTTGGTTTGCGATGCACGATGCATGTAGCTCAC
AAGACTGGAGTCTCAGTGAAGAAACGAGCGGAGAAAGGAGCCATCATCGGCATCAGAGCACAGTAAAAGGGGCAACTTAAAAAAAACAAACAATTGAGTG
CACGTTTTTCGATGATCTCGGCGAATATCCCTCGCAATAAATTAAGCTCCCCTCGCTGCCTGGAGTCGCCCGAAGAAGGACCCATCGTGTCAAAATCAAC
AAAAGCACAGTTAGCTAGCATATAGCAGTGAACACACAATTCGATAAACTCATGCATGTTGAGAAACAAAAAACCAGTGGTCATTTTAGTGCACAGTTCG
AAGTAGAGCACAGATGCGTGTGGGAAGCCGACAGTGGCTCCTGCAAGTTTTTGCACTCGTTCATGCTGAGCTGGTGGAATCAAATGATGAGTTTAAAAGG
CGAGGGCTCGTACCACTGGTATAGCGACCGCTTCGTTAAACACCAGTTTCTTGCCAATATCCACAGTTAGCCTGACCTTTTTGGACACCGTCGCTGAAGT
TGGTAGCAGGGTTAGAGTTTCTCCATATGCACAGCTTCCCGCTGACCCTTCAACCACGCCTCCTTGCTCATCTCACCCATTGCACTGCGATTAGTACACA
CTCTCAGTTTGGACTGCAACGTATTCTTCATTGCGCTCTCAAAGGGCTTGAAGACGGCAACATCAAGTGGTTGATACACGTGCGTCGCATTATCGGCAGT
ATTACCTCTAGTATCTTCATGTTGAGTGCTGCTCCATCAGATTTTACCCAGCACTAAGGGATCGATTTTGGTGAAACTTATTCTCCAGTACTCAAGATCA
CCAACTTGCGTCTGCTAGTTGCGCTGGCAGCAGCTTGGAGACATCGTTTGCGACAAGGCCACGTGCCAAACATATATGTCAAGGCCACATTGTATTGTCC
GACGTTGATGAAGGCCCCTGCGGTACGTCGGAGGGCAATCACACTGCATGACTGCTGCGGAAGTCACTTTATGGTTGAAATAGAGTCATCTTCGATGAAA
CAAAACGGTCAACGCGTTTTTGCTGCCTTTGGGAACTGTAAGAATCCGCTCCCTCCTGGATTCTTTGCGCATCCCTAAAGTACCTCGCACTGGCCCTTAA
TCCTGAATGATTGTGGTTGTACCGCCAAAGTGGTACATCACGATCGTAATTGTGATCGTGGTGGCGATTGGGATCCGGCGTATCGAAATCATTGTACCGT
ATATCGATCTGATCGTGGTCGTTTGGATCGGCTCATCAGAATGATTGCGTATATCAGAATGATTACGCTTGCGACACGACTTGAGACGTGACTTGGGACA
CCACGTGTCTCTCATAAATCCTTCTACGCACTTGCCACACAAGTGGCGTGATATTCTCCTATTTGTGGATCGTTTAGCAGATTTAAGGGTTTCTCGATGG
CACGTGTTTTTTTTAACATTGTGGTTGGATGGTAGATAGACACTTTGACCCTACTCGTCCAATATCAATGGAAAGAAGGCAAATGCCATACATTTTTGAG
CACATGCATCGAAAAGAAAGACTTGAAGAGAAGCTCGGCTTTTCGGGGCGACGCACTTCATCAGCAGGCTTTCATCAATTTACAGAGCAACGAAAGCAAC
AGACGCTGACGAGTTGCGATTTTCTGGATCGACGAGATCGTGGCTTCACCAGTTGTTGCTCTTCATGACGGTGATAATAAAAAGATAATAGTTTGGTAAA
TACGGCGTGCGGTCGAAAGGTGCATGTCAAAATGCATCGTCCATTAACTAAATACCCCTGTGACAGGGCTTCAATTTAGACGCTACTGTTGATGTTCAAT
ATCATCAAGGTGAGCCATGCCTGGAAACGGGTCATATCGCTTAACGGAGGCGGACGGGTGTCTGCCAAGATTGTTTCAATGGTACGCTTACGTGACTCTA
GATGGAGGCGTTGACCGTTCAATCGCCCCGAGCGCCTTCCAGGTTTCACCTAGCTCCCTGTTGTCTTATGTGGACGCATCAACGGCTTCACGAGCCACGG
ATGTCGAGCGTAACGTGAATGGCTTGACAGCTGCCGCTCAGCTGGCAAATCAGCAGACTGGAGAGTTATCTTATATCGCATGATTCCAAGTAGAATGGTT
TAAGCCACGCATTTTGTGGTTTGCCCACATTCGTCACACGACAGGGCCAGTCTGAAACGTTGCTGCCCATATATCTTGCAGCTGAGCTACGACGCCTCGA
AGCGAGCTCTCAGCTGCTGCACCTGAGCGATCAGTGAAAGCCGGGCGAATGCACGCATCAAGAAATTCTTCCAAATCTTGTGCCTTACTAATGACCATTT
CATATTCGTATATCATGAGACAAATAGCTTCTCTGCGAGTTGAAATAACTCACCGCCTCAAGCTTGCTCAGTCTTAGCGCTGTCGAACAAGTGCTGGTTC
CCTTTAAACTGCACCTCGCGGTCTCTGCAACAATCCAGGTTCCTTCCTGCCTCACAAATTGACTTTTAACGCGGGAGCTGAATTTGATCCATAGCTTGTG
CATAACGTTTGCAATCTCGCGCAATTTACAACGAAGTCATCTAACGTCTTGCCTAACATCTCGCGCTGCCCGACCGTGCTGTTCACAGTTGATCGAACTG
CCAGCTGTAGCCGATGTTGCTCCCCAGTTGATGGTGCAACTGGCGATGCGGGAGATACAGGTCGGCCAGCGTTCGTTGGGGCCGCTGGTGGTGCATCTGG
AGATGCGAGAGATACACGTGTAGGTCGTCCAGAGCGCGTTGGGAGAGTGGTGCCACCATATCCGCAACCAATGCATCGGATGTACGGTTGCACGTGATCA
TCACCAACAAACGACGCTTGAGGAGGTGCTCTCTGGTGCCGCGCTTGAATCCACACCGCTGCTAGCGAGTCACGCCTGATTAGATTTGCTTCATTCTGCG
TGCTTAGGGTAGCTAGGGCTGCGCTATGTTCTTCACCGTCGACCATTGCGATCTATCACGAACCTTACTCACGGAATCGCTTCGATTATGCATATTTTAC
GATATTCCAGATGGAGGTCGATTGACTGTGTAGCGGGGCTACACATTCGTTTCACCTCCCACCTTAGTGCAAATACGCACTAATGGCTACATTCAGGTTG
ACCCCTCCACCGAGTGGTTCGCATTCATACCAAAGAGGTATTACTGGTAGAAAGCAGCATGTTTCTATCAATAAGAGTCATTCATTAGATAGGATTGCAA
CACCCTTAGCAGCGCGCGAGGCAAGTTCATCATTATCGTTAAAAGTAACATCAATACCAACGTCGCAATCGGCTGCTTTAAGGACAGCCACCCCGTGTAC
CAACACTCGAGCAGTAGGTCAGCCTCTCGCTTATAGTTCGCTGGTGTTCGGCAAGCGCTCGTATCCGAGCCACAAAGGACGTAAATCAGTATCGCAAAGA
AATTGAAACAGCAGCGGGTGCTCACGAAAAGTGACATCCAACAACTTGAGTGTTCCATTATCATCCGACCTGTGCAAATTTGCCGGTGACATCTGTACTC
TGATGTCGACATATTTGATGCTCTGTGAGGCAGAAACGCCCATCTGAGTGGGCGAAAACGATGTTTTTTCGTTGAGATGGACTTCTACGAAAGAGCAAAT
CTATGCCAGTGTTCGCATACCTTGTGGACACTCCGGTTTAGTGGCAGCACAAGTCTATTGTAGAGGTCTAAATTAGAGGGCAAAATAAACGCAAAGCAAT
ACGATGAAAAATGTATTATGCACGAACTAAGCCAATCAGAATCGAGCCTGGGATGTATATTTCCGTAAAAAAAATATGATGATCCAAAATTCGCTCTATA
GCTTTCTTGCAAGAAAACTCAAGACAAGAAGAGGTGTAAGCGCTATTTTGGCAATTATCTTTTTCCTCTAAGACGTCCTAACAAAGTGTCCGTCTGTCGG
GGTTGTGCTGTGGCATTGCCTCTTGCGAGGCGACCAACAGCTTTGTCTGGGTCGTGCTTGATGTGCTGTCGCTTGGGTAATGGTATACTGTTGAGGTCTT
TTTTGACTTGGCCAGGAATTTCGCGCTGAAGAAGTTAACTACGAAACGTTTTTGAGAAGTTCAACCATCAAATCTTGGATTCATACGTGTACAATTGTCA
CTGACAATCTGTCAGTCAGACTTCTTCCTTGCGCGACGGCGCTGCCTCGCCCTCTTCCTCGTAGTCGGCCATGTCTCGATGCAACGGGACCTGCAGCGAC
AAGAACAGGAAGGCGAGTACTTGCAGACTCATCGCGATCAGAGCGAGAGCTGCCACGTCGTAGTACCGGTTGGCGTAGTCCATACCCAGCGTCTTGAGGT
AAACCTCCCCATACACGGGCACGGCCGGGTATCCAGGCGCATCAAACTTCAGTATCAGGCCCTTCAACTCGTTTGTCATGAGAATCTCGAACGCGTAGCT
GAAGATGGACAGATGCTTCAACCAGCCCACGGACGTCGGCATGGTCTGCGAGTTCAGCAGGAAGCCGCCGAACAGCAACATGACCAGCAGAACCACCGTC
GCCCCGAGGTTTGCAGAGCCAACACTTCTCGATAGTACGCCCACAAGCAGGCAAATCGCACCAGCCGCCACGTTGAACAGCACCAACGTCAGCGAGAACA
GCAAGAAACGCCCCGTCGTGGCCTGCAGTCCCATTATCCAGTAGAAAATGCTCGCAAAGAGCGAGGCAGGCAGTACCCGCAGCAACAACGTG