Description :
From Genome Similarity Track
Location :
contig_76:117254- 149364
Transcript NameFunction/comments
g10072.t1hypothetical protein
g10073.t1conserved hypothetical protein
g10074.t1hypothetical protein PHYSODRAFT_538644
g10075.t1hypothetical protein PHYSODRAFT_488092
g10076.t1isoamyl acetate-hydrolyzing esterase, putative
g10077.t1hypothetical protein
g10078.t1phospholipase D-like protein
g10079.t1hypothetical protein PHYSODRAFT_308430
g10080.t1hypothetical protein PHYSODRAFT_255250
g10081.t1hypothetical protein PHYSODRAFT_255250

Sequence
32110 bases(100 bases per row)
TCCGTCATGATGCACTTTGTTTTGACCAATTACAGAGCTGAGTTTATTTGGCGAATCAGAATAACTCGCTGGTTTTGTCGAATCAGCGTCGGCTTATGCT
GACCAGTCAGCCTACTGTACTTGACATACAAACATCAAGTCAAACGTCAAACCGCTCGCGACCACTGCCTCACCCCGTTCACTATCGATTTTGCTTTGTG
GACGAGAGTTGAATGATAAGCGGTTTTGTGCATTATTATAGCGTTTACAGCGCTGGCGATGGAGTGAAGATACCTAACGTTACATAGTGATAGGAGCGAG
GACCGTTTTGGTCTCTCCTCCTTCTGTGAGCATTACACTTTGTCATAGTTACACTGACCATCCGCCAACCCACCAAATATCTGTATATTCCAGTAGTGAT
CGAGCGTATATTGTGCTGCGAGTGGTCGATGCTGAAGAGCGACGATATTTTTCCAGCCAACCTACCCCACAGCACCAACACTGGCCCCCACGACAGTTGT
TCTGTTGAGAATACCCCAGAAGTGACTTCACTCGATCACTCGTTGTACTGGTGCGCAGTTTTCAAGCCTGGAGAGTGATGAAGCGAAACACAGTACCAAC
ACTGCGACCGGGGTGCAGTTGTTCTGACTGTCAACGACCGTATCTGACTCCTTCGAATCCTATGGCATAGTGCTATAGGATGTTAGATCAAGTTGTGAAT
GGGTGTAGTGTGCAGCCTCTCCGCAGAACTGATGATTTATCAAGCCCTTGTTTTTTTTTTTTCAAGGGCAGTACCAACTATCTTTCCAGGAGACCGTTCT
GTTGAGACCACAGAAATGAAATACACCAGTTTTGGAGTTTTGATCATATCCCAAGGCCAACATCGATTATCATCGGGGGCTACGTGTAGTTGTGTTGAAA
TTCAGTGGCTCACGTGCCTCAATCAATTGTTGTAACGTGGAGAATTTGATCTAATGCCCCATGCCTGAGCTAGTACTTCGACTGGAATGTGGCTGCCACG
AGGTAAAAGTGCCGGATCGAACCAGCGACGCTTTCTCATAAGGGACCTTGGTGAATTCTTGGCAGCAAGCTGAAAAAGTTCCAGCCTTCAAGGATACACG
TGACTCCACTCGTCCCGGCCTCAGCGCGCACAACGCGCACTCCTTGCAGATGCCGAGCGCACAAGTCGTAGAACTCAAGCAGCAGATATTCCGTGCTTTT
CTCCTCGGGTGCTTCGGGAATATTGTTGGTAGAATGATTTGGGTCATGTTGAATATGACTGTGCCGTGCTGTTAGCTTTGGTGTCTCGGACACTCTCGAC
GTTGGTGGGTTCTTCATTGCTGCTGCCGCGAAAGGTGCGAGGGTAAATTCGTTTGAAGACCCTGTTGGCCGCAGTGTATGGTGCCCTAGCACCTGGCGAG
CTGCACCAGCCATAGCATAGCTAGTATCAGCAAATTCAGCTCGCAACGAGTCTCCTTTAGCTTTCCACTCGCCAGCAAGTCCTCCTGGGGTCTCTAGCAC
GTGGGTGAGTAGTTCAAGCCACTGTGGTGATAAGACACTGCGAAGCCACTGGTTCTCCCGAAGTGCGGCCCCCAAGTTTGTAAACGCCCACGCTGAGCTC
AGCTGTTGCGAGTGTCTGAGCGCGTAGGCGACACGATGAAGCGACTTGATCAGCAAATGCTGGCTGCTCTCAGCGTTAGAGCTTTCGCTTTGAGAATTAT
GCAGATTGTCGTGCTGATTATTTGGCTGTGTTGATGCCGATTGACGTCGTTGGTTCAGCACCACCGACTTCTTTTTCTTCTGCTCACGCTCGGCCTTGAC
TTGTGCGATATACTCCGCGTCCTCGCGTTCATGAGCCAGGTCCGCTTCGAGTTGATACGCGACCTGGGAGATAATTTGAGCCCACGCCTGCCGATTCAGC
CGCAGGTCCATTTGAGTTCGACAGGACCAATGGGAACCAAGATTGAGATTCTTGGCTACCAAGAGGGCCTCAAGTGAATGGCTGCACAACCAGCGCAGCG
AAAATCGCTGCAAAAGGTGGTCAAACTGCATGGACGACGGCAAACCTAGCGACTGCATCACATGATACAAATCCATCTCTCCAGTGAACAGGATCACCAG
TCGAACTACTGGCGATGACGGTCCAGGAGTTCCACTGCTTGATGGCCCCATGCGTAACTGGGGTTTCGTCGGTAGTGTAACAAACCAACGGTGGAAGAAC
GGTAGCGACTCGATATGATCGCGAAAAAATCGCCCAAGAACCATGTTAAACGATCGACTAGAATTTGAGCGTCGCTGTCTACAGTAAGATAGCCACATAC
AAACTAATTAGATTTTTCCTGTACGGTTGCCAGTACCAGCAAATGTACCAACCTTTCGTGCCACTCCGACAGGCGAAGTCGATGTACATGAAGCATTCTG
CACCACGCTCCAGATATTTCAACTCGTGGAGTGTGGCAGCAGCTGCACATTGCATAGTGTATCTGGTTAGGTCAGCTCCCAACTCAAACAACAAAAATCA
CTTACAGTCAGCGTCCGAGTTGTAAGTGAGATGAACGGTAGCGGTTGTAGAAAACTTGTGCCCTACGTCAACTTTCACCATATAGTCGCCTCGATCGCCG
CCAGGAGTGCGAGACAGCAGACAACTCGCAGACAGCAGCCCTGTGGCCGCTGCTTGGCGCACATGTTTAAATATCCATTGAACTCGTTGCTTGAGTCGTC
TCAATGCGCAGAAGGAATGCAAACGGCACTGCAAAAAGAATCTACGCCAGCGCTTCACCACACCCACGTCTCTATCAGCACAGAACCAGCTTCCAAGTAG
CAGAAAACGCAATGACTAATCACGTACCTACCGTTTTCACAGCCGGACACCAGGAAGAGGACATCAAGCTCAGAAACCCAACCTTGCAGATTCGTGGCTG
TTCCTCATTGTGCTCACTTCGAGCATGCCCTTCATTCGTGAATCGTAGAGCCGACTTCTGACGGTATCCAAACAAACGCAAAGTACGCTTCAATTGATGT
ATAAACCTCAGACAACGTGCGAGTTCGTATCTCTTGGCAATGATCTCCGCCGTCTCGTCGCCCGTTAGGACAAACCCACTCTCGGCTAGCAAATACTGCG
CAGCTTTAGCCGTCACTGAACCCGTCGGATCATCCGCATACGCGTCAAAAAGCTGTTTCATCGTCTCCACTCGCTCGAGCTCTTCCCACTCCAACGAAAT
CCCCAACGACGCCAAATCTCGTGTCAACGGCTGTTCGTCCTCAATCTGCTCTCGGTACATGACAAACCCTTGGAACGTAAGCCTCCCTTCCTCGTCCAGC
TCGCACATATCACTCATATACATTCCCCAGACCTCTGAGCTCTCTTCAAACGCCCTCAACTCCACTGAATCGCTCGAGCACTGCAACGCCGCCATGTACT
CCAGGAACTCTTCATGTGTCCACCTTTCGTCCTCGTCTGCGTCAAAAAGGGTCCAAATCTTCCGACACTTGGCTTCTCCCAGCGGCGACAGTCTCCACTC
AAGTCGAACTGCATCTGGAGCGTCGAAACCAAATCGAAACGCTGCAGAACTCGTCAAACTCGCCACAGTCCGTCGGAACAAGGAAGTGGTCGGGTTCCAA
TGGGTAGCGGGCGACTCCAATAGGTACGCGCTATTGTATCCATGCGTGACAGCTCCAGCCTCCCTCAGAGAGTTCTCCACCGCCCTTAAACTGGATCGGA
TCTCGTCTCTGCGCTCCAGAATCGCCGCCTCATTCGCGGCCAGCGCTCTTCCTCCATATTGATACAAAATGTAGCCATCTGTAGTTGAAGCGGTGCGATC
TTTCATTTTATTGGTAGAAAAGATGGATTTCCAACCAATTAAAAGGATTTCATTTGGTGGAACAAGGGGAGAATTTGATTCACTTGGGACCTGATGGACG
AGGCGAGTAAGGCGACGCTGTTCAACGCGCTGGCGTGGGTGGACACGCTCAAGACGCGTGAAGGCGTGGATGCACAGGAGATCGACACGGCGCTCTCCCG
TCTCACGTAATTTCAGCATTTTGCTTGGTCCTACAAGCTGCAAAATCTCGATATGACGTGTTTTTCTAACGTAACATTTACTTTTTTATTATTATTTACC
ACATAGTGAGGCTTTCGGCGTGGACGTGCACGACGCCGAGCAGCGACGACAGCTGGCGGTCGATGGCGACGCCTCATTCGACGAGATTTTTGCTGCGGGG
CTCAAGGCGCTGAACCTGGAGACTGGCGCGAAGGAGGCTGTGGACGAAGATCCTGTCGTTAAAAAGCGTACGTGGATGATTTTTATAAGAGAAGGAGGAG
AGCGCTGATTGGCTGCTTCTTTTCTTATTTGTCAGACCCGGAGCTCTGGAAGAAGTGGGTGGCCAAGCTGGAAGCCAAGGGTTTCTTCAAGGACGCGGCC
CCTGGCACCAGTGAACATGCTACCCGTACGGCCAAAGCGCTGGGTAAATTTAAGGAGAAATTCGGAGATGTGAAGCCGGAGCTTTCCCAGGAGGAGAAGG
AGGCCAAGGCGGAGGAGGTGAAGGCCCAGGGCAATGCGGCTCTGAGTCGCCAGGACTACGAAGGAGCTGCCAAGTTGTATCGAGAGGCGCTGCAGCTGTC
ACCAGAGGGACCGTCGTCGCACATTTACCACTCGAACTTGGCTGCGGCGTTGATGTACCTGGGCAAGTACACGGACGTGATCGACCACTGCGAGCAGTCG
ATTGTGCTCAAGCCGGCGTACGTCAAGGCCTACTCCCGGTTGGGCAGCGCGCAGCTGCAGCTGCAGGACTTTGACGGCGCTATCGACTCGTTCCGTCGTG
GACTTGAGGTGGACAGCTCCAACGCTGCTTGCCGTGACGGCCTTGCAGATGCTGAGCGCAAGCGCCGCCAAGTGCAGACGACGAGTTCTTCTTCGTCAGC
TACACCCCCTGCTGGTGGCGCTGGTGGCATGCCGGACCTGTCGAACCTGGCCAGCATGCTGGGCGGAGGTGGCGGTGGCCTCGACCTCATGAACAACCCG
CAGATGATGCAGATGGCCCAAAGCATGATGCAGAACCCGCAGATGATGCAGATGGCGCAGAATATGATGCAGAACCCCGACATGCTCAGCGGCCTCATGG
GCGGCCTTGGCGGCGGTGGTGCTGGCGGTGCAGCTCCCTCTGGCCCTGGTGCTGGTGGCATGCCCGACATGAGCGGCCTCATGAACAGCCCTGAGCTCGT
GGCGGCGCGATCCGACCCGGACCTGGCAGATTTCTTCCGCGACGTGGACGCCGAAGGCCCGTCGGCCGCTATGCGCCACATGTCGAACCCCAAGGTCTCG
CAGCTCATGCAGAGCGTGATGGCTGGGATGCAAGGTTAGACAGGACAGCAAGCAATAGCGACGCAGCCGTTCTACTGCTTGCAGACGATACGAGGACTGT
AAATGGCAAGTGGTGAGTGAGGCTCTAACTGTTTATTGTGTGCGGTGTGGTCGTCACGAACCTCAAGCAGCCTGTACGGTATGCAGCAATACGGGTTTAG
TGCTTGACGAAGCTCTCGGCGTCCTGGAGGAAGGTCAGGTACTCGCGCTGCTCCTTGAGATCAGCAAACTGCGCGATGAACTGCGCCAGCTCGTCGTCGA
TCTTGCGCTCGGCCAGGTAGCCGTAGAACTTGTCCTGCACGTCGAGCTCCAGGTCAATGAAGTTGGGCCCAAAGTACAGCGTCTCGTCCTCCGCGTCCTT
GGCAAGTCGCTCAGGTAGCGCACGCGCTCCACCGTGAGGTTTGCTGGCCACGCAGTCGAACTGCAGGCCCTTGTTGTCACGGGTCACGTCGGCCGTGAAG
CGGACGCCCGGGAGCTCGTCCTCCTCCTCTTCGTCTCGTCCTGCTCCTTGCTCGTCGTCCTGCTCATCGTCCTCATCCTCGTCGTAGTCCTCGTCGTCTT
CGAGCTCCACAGTGTCCTGGGCATTAAACTTGATCCTGATGGACTCGGAATCCACCGAGCCCTCGAGCAGGACGTCCATGCAGCCAGGAGTCTCCTTGAG
GGCGAACACCTCCTCCACCTTGAGACGCAGAGCCTCCAGATCGGGCTCCTCGAAGCAGTTGGCCTTCTCCTCGGTCACTTCGCGCTGCAATAGGAAAGAA
GTAGGTAGTTTTAGGTTAGAACGCGGTTTTTACTGGATTGCGAGCGGAATTTTACGAGTTGCATGACGTACGTTGAGAATGGACACGAGCGTCGACTTCT
CGCGGGTCTGCAGGGCACGCAGCGCCACAGAGGGCGTGCGGCGTACGGCGGCGAATGAAGCAGCGCGAGCAACTCGGGCGAACATGATCTCGTCCTGGAA
GATTTGAGAGTGCGGTGGAGCAGCTTGGCCACATACTAGATGGCGTGTGATTGGCGGAAAAGAATGGGTTTCAGCGAATGAGGAGAGCGAAGGGCACGCT
GCGGTGCCCCATTTTCAAGAAGAACTCACACTTTGGTTTTTCTTCGTTGCGGTTGGACTTTTTCTTCGTTGCGGTTGGACATTTTCTTCGTTGCGTGTGT
GCATTTTGGTGGCGAGGATGAGAAAACGATTGACTCTCGAGTTCCGCGACAACCCCCCCGGGTTTTAGATGCATTTGGGATCTTATTAGGCTGCGAGTGG
ACAGGAGAGCTCCACGGTCTCACTCGTGCGAAGGATTCACCAATTGACCGGGGAATAGTACGAATCTCCCATTGTAAAGGCTGAAGAGGCTACTGCGAGA
GCCCCACGCGTATGTTCTCTAGATGGTGGGAGGGACAGTTTCCAGCAATTGGAAAAACAAACTTTAAGAAGGAGGAACTAGGAGAGAAACAAAAAGGCGA
AGCTGAGCCACCAATTCACAATTCATGTTGAGACTTGGTAGAGGTAGATACTGTCAAAGTCTTGAGCGTCGTCTTCATGGACGAGTTGACTTTTGTCGAC
CGATTTAGCAGACAACCCCCAACGAGAAAGTAGCGGCGCGATTGATCGGTTGATACTTCGCAGTTGGTACGACAAGTAGAACTGGCAGGACGTGCAGTTG
CTGCAGCGGAAGATGAGAGCGACGGTGGCCAGCACCTTCTCGAAATCTGCAAGTTGAGGGAGTTAGATGTGGTTTTACAGTTGATTCTGTTGCGATTGTA
CCTTCAGACTGGTAGAAGCAGTCGGCGGCGAGGATGACTTGGACGCTTCGGAAGATGGCGAGCACTTTGTCCGGTACGAGCATGTCGCCCCAGGTGAGTC
CAATGAACTGGGCACGATCCTCGAGACCGTTTAGCTTGATGTTGACTTCTGCGTTGCGCTGGACGTCGACAGCGTCGGGTCGATCGGTAAGATACACCTT
CGTCGCGCCACACAACCCAGCGAGGATCGACGGGAGGCCAGTGCCGCAGCCCAATTCCAGCACAACTTTGTCGCGACACAGCGAGTCGACTTCGCGGGCG
ACAAATCGCGACAGCAAAAGTGCGGACGGCCACACAAACAGCCCGTAGTGCTTGTCATTGTCTTCGTTGGCCTCGTCGAGGTCACGGATAAGCTCGACAA
GCCGCACGTCGACGATGGAAGTCTCACCAAGGCGTCGCCGCTTCAACTTCGGCTCTACAGCCGTCACCGCACCTTGAGCTTTATCCAACGGCACTGCTAA
CGCCGCGTCATCACCACACGACCCACAGACGAAGCTGAGCGTGCGTTGCGACGCAGCATCAGCGCTCAAGGCCTCCATGCTGCTGCACCAGTCACGAAAA
CGGGACGGAAGCGATGAGCTACCCGTAAACTACTGTCGACGAACAGATCCACTTCAACTTGGGAAAAGGATCTTGAAGCGGATTCACCAATGCCGGCAAC
GCGACGGTTGGAACTGACGGCTTTCGACCCGCAGGAGCAGTATTGACACCAAACTCGAAGGAAAACGGACTTGGACATGCAGCAAGACGAGGTTGACCAA
GCTCTCGACGCCACCATCTTGCTGCCTGATGAAGAAGCCTCGCTGTCGAAGCAGATCATCACGAACTACTTCACTAGCGACGGACCACGAGCAAGGAGGC
TGGGTTCCAGCGACCTCGAGCCGGAGAGAAGCATTTTGGATGAAAGCAGCGGAGACGAAGAACTTCGACATTCTGGGAAGATGCCAGCCGAAGTACTACA
TGAAACGGAGAGAGAGCCATCGGAAGTATACGAAAGGGAGACCGTGAACTCTGGAGTTGACAATCGCGAGGAAAGAACGATGGGGATGCTCGAAGAAATA
CTGACCCTGGGAAATCGCGCTGTCAGTGGTAGTCGTGATTTTGGCCCTGGCGCACTGCGTGTGGATGTGGAACTTGGTGGAGCTCAGCACTTTGAATTTG
GAGTTTGGAGACTAGAAAGTGTGCGCAACGAATACAGTTGGAGATTTCAGCATGCTATGATGAATATGCTACTGATCTGTCTGTTGAATGTGTGCACTAC
CTTGCGCTGTGGAGGACTATAGCTGCAGACAAGCTTCGATCTGTTGCTGCATCCGTGTTACGTGTTGACAAGAGAGGTCTCCAGTACCTTCTAGGCCTGG
GGTGGCACACGCTGCCTCGTGGAGCAAGGTTAGCTGACTTGCATCGAGCGTTTTCAGCACCTCTTGAAACAGGGCGTCTTGATTAGCCACTCCGTTGGGC
TCTTGCATCTCGCCGACTGGCGACGGTTGCTGAATTTCCTCCTCCTCGTCCCAGTTGTCCCAGGATTCAAGTGCTGAATTTTGCTTTCCATTAACACCAG
ATACGGTGAGGGCCTGCTGTCGCTGGCTGTAAAGACTGGCAATTGCAACCAGTAGCTTCTCCTTGCTACGGTTGCCGCTAGTAGTGCATGACAGCCACAT
TTGCAGATAAATATCCAGCAAGTTGGCGTACGTTGCGTCTTTGATTTTGGTCTGCGGAGCACCAAAGGTGTCACTGAGGCACTGAACAATTTGTCGAACT
CTTCATATAGTTGGTGAGAGTTCGGGGAATGAAGTAGCATGCTAAGACTTTCTAAAGGCTGGATTGAGCCTCTGACTTGTTCATCGTGATCCAGCGAAAC
ATGTCGTGCACAATAGCCACGATAGAATGATGCGCTCCAAACACAGCCATCGAGAATACCACGACAGGCCAAAGTCACGTGGTTGGACATCATCTTTTGC
GGTTGAATCCACAGTTTCAGCCACGTAGTGCATCGTCGAGACAACGACCGGAAGCATAGGCACCAAGAAAATGCTGAACTGACGATCCAGTGAGCTATTG
GCGCTCACGGTATTTCCCATTTGCGTTCCTAGCTGCAGACTTTGGGGGAGATTTGCGTGCATCGCTCGTAGCGCGCCATCTAAAAGCTGAGTTAGCTGAC
GAGGTGGATCTGCTGTTCCTCCGAAACAAAGGAACGCTAAAAGCCTAATCTCTACTTGCCCCACTGCTGTTTCTGTATCAAGCGGAAAGCTCTCCGGATT
CATTTCCATTGCTGCGATGCCGTCCCACACAATTGTCCAATCCTCTACTAGTTTCTGCGAAAGAGAACTCGAAGCACAGCTACCTAAGGCATCCACACTT
TCTTGCAAGTACCGTAAGTGCAGCAAAGTGAACTTCGCACACGCACAGCACCACGTGTGTCCGCAGAACCGCTCTGAAACTCAGTAGATGAGAGAAATTC
CAGCTGATCGGTCCAACAACTAGCCTCATTAACCCAGGAAGAAGCTGCCGAGAGATTCTGCGAAGCTCAAACTGTGAGGACTCGAATGCCTCTTTCGTGT
GAGCGATGCATCCACTCAGAATCTGCTGCCAAAATCCTTGGCTTGAAGCAGGTAGGTCGTTTTGGCCACGATGCGTGTCCACCCAATCGCTAATAACCTG
GACAATTGACAGGTTCTCTGGTTCCTCCTCTACTTCATTGTCATTTAGCACCCATGTCGCCCGCTGAGCTTGATCGTGTGCCCACTGAACTGCTTGCAAG
TGGGAAAGAGACGTTGATCGTCCTTGTCGAAGATTGGTAGGCACCGGTTTCCACCTCAACAACTCATTGGATTGACAAGTCACAAGACTTTCGCCAAGCA
CGTTCATAAGGACTTCAATGCTCAAAAGACGACCTTCTCGTTGTTGCCAACAGAATCAATTGCATCTCTCCGTTTGTTAGACAGAGAAAGTAACATCTGC
TCAATCAGCTTCAAGGAGGCCTCGTCAAAGGCCGAATTTGCGCTTGGCTCCAATTCGTCATCCACAGACTTTCCTTGCTGGATACCGCTCAAACCAAGCT
TTGCCAGCGCCAACACGACGCTGCTGCTCTTTTGACGAACACTGGATGCGATGTGCATGACGTATTTCTCCAGCGTTGGAAATACGAACTTCCAGTGCCT
TAACAAGAAGCGTGAGGGGAGACATGGAGCCATCCGAGCTAGGACATCCAGTAAGCCTTCCGCCTCAAACGCATCCAGAAGTTCTGACTCGCTGGTGTTC
GCGATACCGTCACTCTCATCGACCTTGTCATTGCGGTTCATGCGGTTTAACTTGCTGATCACTTCCTGGAAAATGAGTAGCCGTGTTGGGGTTTCACAAA
GTGCGGCATATTCCACCAAACATTGGGCCGCAAGCTGCCGAACAGTAAGCTGGTCGTGACGAAGACACTGATAAATGGCTGGCTTCAGCGTTTGTACTAG
ACATCGCGGCAGTTGAGTGAACGTGTGACGCTCATTCGCCCAAGTCGATATCTCACTGCTGGCGATTGACGGACGCCCAATATGCCCTTGATATCCTCTT
TAACCTGAGAGGTCTTGGGGTTTTCGGGTTGTGGAGATGTGGAGTCCATTTTAATGGAGCGCAGAAGATCTGACAGCGCCAACAAAGCTCCTTCTCGCTC
CGTCCACGCTGTCACTTGGGTTTTGTCGGCGCTCACACTTCGGGAGCCGACAGCGACACCGAGCAAACTGTCCATAAACTGCTCGATGTGATTTAGGGAT
GGAAACTCAAACGCGATGGCTGCTGCATTCTTCGCGCAGTCCTTCCGGATTGCAGACCACAAGTCGGTCACACCAAGTAACAGCAGCCGAACTGCTTCAT
CAAAGAACTTGACATCAAATGGTGGCGATGACCCCGCGCGTGCAGCCTTACTCTGCGATGCTTGCCGGAGTATTTGGAAGGCGAACGTCAGAAAGCGTTG
GCGAGCCCGAGGATCCTGAATTCGCTTCACGACTTTATTCAGACTGGAGATAGCAGCAGCATCCCACTCGTTGTCAAGCAGCAGTCTATGGTACACATCG
CAGGTTAGACTAGACGAGGCAACAGTTATGAGACCAATACATCACAACACACCCATGCAGCACATCGACAAAGCTCTGAAACTCGGCAACGTCGCGTCCC
TCCCAGTCGACAGAGATTTGCTGTCGATCCCTAGAATCAGTTTACCTCCTGCAGAATCGGTCGTAGCTCGAAACTTTCGGACCACCAAGTAAAGTAGCAG
ATCTTCTAGCAATGACTGCGAGTTGTTACGGCATTCGTCGTCGCTATCAAATTGCAAAACAGGAGACTCGCAGCTCAAAGGGTGACGTCTATCTGCAGTT
TTTCACTTGAATCCGAGGCTGCAGCAATCGACGAAAAGGCTCCGAGCTCCTCGTCGTGGCCTTCAGCTAACAGCAACGCCGCACCGACGCCATGCAGCTT
GCTCCGCTCTTACAGACTGCGACTCCTGGAGGTGAGGGCGGTTTTGCACACGCATGAAACTTGCACATGCATTAATATACATGGGTTTGGATAAAACCAT
CACCTGCAAGTAGGCAACCGACGACGAATGACGCGGTGGCCGTTCAGAAGCGTCTCGTGATGCTGCGAGCGCACCGAGACTGGAAAGAGGTTTGAAAGCG
GGAGTGAAGGAATTCAAAGGAGCACAACTTCAACCGTCCAAAGTCGGGTTAGGCCCAGGCAGGATTGGCAGGGGGCCAAACTACGACCGGACATTGTTCA
CGCACCCCATTTCGTCGTACGTACCGCGCAACGGTCGCAATCACGGACTGTGCCTATGCTGTGCCACAGCCTGTGCGTGAGCATGAGAGCAGATCAAGGT
GATAGATATCCTGTTCCGCTCGTGATCAGTGTCGCCAAGTCATAAACTGCGGTCTGTCGCCAGCTATTCGTGCACATTCGGAAATTCTAGCGGAGAGCAT
CAAGTGTTTGGAGATAAGTGCTATCGTACATGACAACGCTAGTGATGAGTTGAGCGCATGTAGTCAACTTGCTAGCCAATTATCTGTTATGGTTGTCAGC
CTCCTTCCTACAAGAGACTGAGATTTCGAGATAGGCGCTTCCCGGTTGTACACCGTAGCGCGATGTATTTGTTAGTAACAAGTCATGTTCATGTACGTTG
TACACACGTTGTTACCGCAGTCACGAACGCACACAAAAACCTACGCATACATGTATCGACCGTGCTAGGCAATACACTCACTGTATTGCCCAGCACGGTG
TACTTTGCACCTCACACAATCGAATTTGCCGCCACCAACGCCGTTCTATTATACATGATGGTGATTTCTTGGTCTGCTTCACACTCGTAGCCTCCCTCGT
TTTCTCCGCGCAATCGCAGACGACTGTCATGGTGACTTCAGAATCCCAGTCCAACGCTCGCCCGGTGCTGTTGCTTACGGGAGATTCGCTCACAGAACAC
GGCACGTACCCCTCGATGCTTGGCTGGGTCACGCAGTTGCAGGCCCGATACACGCGCTCGGCCGATGTTATCACCCGTGGACTCTCCGGCTACAACACGA
AATGGTTCCTGAAGTACGTGATGCCCGTCCTCGAGCAAGAGATCAGTACCAGGAGCTACACCGTTCCGTCTCTCATTACGGTTTGGCTTGGCACCAACGA
TGCTGCGCTGGTAAACGGCAGCAACTCGGAGATGCACGTCCGTATCGAGGACTACAAGGAAAACTTGATCCAGATCGTCAACGGATTCCAGAAGACAGCA
CCGAATGCGAAGCTATTGCTGATCACCCCACCACACATCGACGACGGTGCCAGAGCCAAGTACGCAGCCGAGCGAACTGATTCCAAGCGCGGTCTCGTGG
ATCGCTCGAACGCCATGGCGGGAAATTACTCTCGCGCTTGTGTGGAAGCCGCCGAGGCTCTCAAAGTTCCTTTGCTGGACTTGAACGCACATTTCAATGC
CATGCCCGTGGCGACTCGAAACGCGATGCTGGAAGATGGGATCCACTTCAACGCGGAGGGCAACCAAGTGGTCGACCAGCAGTTGCAGAGCAAGCTCCAA
AGCGAGTTTCCCGAATTGATGACCTCGTTAGATACTTGGCAGGTCCCAGCGGCGAGCAAGTACGTGTCAGAGGACCCGTGGAAGCCTGAATAGGGGATAT
TGGACGAAGACTGATACTGCCTCACAGATTGACCTAGTGACGGTATCCGCCGTTGATGACTGCGCAAGTAGCGTCCTAATCACCTCAAATGCTTCACCTG
GCGTGGTTAAGGTCGTAGTCGCTATGATGGCACGGTTGTCGCTCTTGCTAGAGACCCATAAAAATTCCCAATGGTTTGTCAAGTTCGTGAGAAGTGCCAT
CACTGGTTCCTCGACGATGAAATCCAATGTAATCAATTCCGACAAAGCCTGGAACTCGGACGCTGATTTCACCTCCCTTTTCACATTCTCACTCCAGGCA
AATGATGCAAATAATGCGGAAACTTCTGGGCTATAGCACTCAGCACGATCATATCCGTGCGACCAACAAGATCAATATCGCGACCAGGACTTCAACGGAG
AGGATATTTGCGCTTTCTTCCACACCAAGCACGCAAAGTTTGTTGTTCCTCAAAACATCGCCAATGTTGGCTTCCACGTACTCACGATAACGTCCACTTT
GCTGCTCCTCGGTACGGCCCCCTATCCACTCAAACTCCTCAGCTGGAGTCGGACTTCCACCGGTGAATGGAACTGTGTCCACAGGCGCAACCCGAATTTT
CAACTCTTTCATAGGGTTGTTTCCCTTGGTTGAACTCACTTCCGAGTGGACATATCGCGTACGCTTGGACAGCACAGAGTGTTCATACAGTTTGTCGACC
TTATCGACTAGACGATCCATCCTGGAAGTCTCGCTCGCTGAACCACCAGCCCACCGCCAGCACGTGAATTTGCCTTGGCTTTGGAGCGGTCATGTTGTTG
GCTATCAAGACATCCTGAACTGCCCACGTAGCCTTCAGCTGCTCTTCAGTGGTCACCTTTCGAACATCATCAATCCCCCCTATCCAGTTGGAGAGGAACA
GAATCATCGCCTGGCAGCCACGCGCCACCCTCCGTCTTCGCCAGGAAGAGCTGTAGGTTACGGGCAGGACCCTTGATGTCTTCGTTCTCCGCCTTGATTG
TGTCCTTCAAGTCATCCACCGAGTCGCTTTCATCTACTCGCACCGAGAAGGCGCTTCCAGCGACACCGACGACGGCACAGAAGAGAGTGACCATCTTTCC
TTGAGTCGCGTCAGTGGAGGAGGAGGAGACCTGATTTTCTCGAAACGCCAACGCCGAGGCCAAGGTCGTGCACTACCTTGGATTGGTCGCCAGACCAGGG
GGTTCGCTGGACATCTGCAACATGTCCATAACGAACGATCACATTGGGAGGCCATTCTGAAGACGCTTGCAGAAGGCTGCATCACTCGCATGATCGTCGA
CGAGCAAAGCGCACTGCAAAACAAGAAAAACATGTCGTGGCTACGCAGATTCAAGGACGCGGGGATCCCGATCAAGACTGGGCGCGTGGCCAGCTTCATG
GTCCACAACAAATGGACGATCGTCAACGGTGAGTTTATTTTACAAGGCACGGGCAACTACAGCACGGCCGCGTTCGATGGAGTCCGCCACGCAGAGACAT
TTGAGACGCGCACGGCTCAGGCGCACCTTGATTTGATCATGCGTGAGTTCGAGCTGCTCTGGGAAGAAGGACGGGTGCCCAGAAATTCTCCATCCCAGAA
TCCCAGAACAGACGTTTCGTGCAGGGCACGTGTCCTAAATTACGGGTGCTGGTAGGAGAGCCGGCTGACAAGGCTGCTCCCTGGTCCCCTGGTGCCACAA
CGCCACACCTGGGCTGCAAACTCTCTCCTCGTTCGTGCATGCTGTAATGCGCGACCGTCCGTCGATTCCAGCCCGGGTGCTCCTCGCCTTGAAGCATCGG
AATGTACAGTCTCAAGATTTGAACGCTGAAAACAAGAGTAAGACTTCACAAAAGCCAGCTTCGGTATGTTACAAGATGAATTGGTGTCTGCTCTCGTTCG
TGTCTACTTCATGCCACTATCAACTTCTAATACATTTCGCTACATTTCGCAGCGTGCTTCACACTTTACAACTTGGTCACACCTGACCGTTGGCGGACGT
GCTCGGAATAATGAGCATGGAGTGGCGAGACGTTCGAGACAGGCTGATCCTCCGGTGCGAACTGTCGTACGGCGTGCTCAATACAATCTCCTCGCCCTGC
TCCGGGTCATCGTGCATCACACACAAAATTGATCCGTTGTCGCGACTGGAAAATGGATCGAACCCAGCAGCAGAGGTACCGAACATGGCTACGCGTGAAG
GCGGAGGAGGCATCGGCAGGTTCTCAGCTGCCAACGTTTCCATAAGTCGGTCGTAGTCAACCGAGTGGTGGGGGTAGGTAAAATCCATGTACAACATTAC
TGTGGGAAAAATATTGTTTCCGATCGGGCATCCGTCGCATCGAATCTACATCGTCTTCTAGGTTTTTGGCGTTTCGCAGTTGCTAATGTCGTCTTTGTGT
TGCTCGGACTTCGAACAGCACATATGTAGCACTTGCTCGCTCGACTACTGGTACTGAAGTACATCTTTACTGTGGCTCTCGGTCCTAGAGAGCTCTGATG
TTTCTAAAGTTCTCACCAAAATCCACAACTCAGCAAGTTTCCCTCACGGAAAGCTACTTCATTTCAAGTAGTGCCTACAAAGATAAAACTCTTTCTCCGT
CAAACAAGTTTCCTCGTTCGATAGTCTTTTCCCCCTCTTTTACTCGGGTGCATTTCACGATGTAATTCTGCGGATTGCGGCCAATCCAAGATGAAATTCA
TTGCAGGAAGCCGTGCTGAATGGGCTACATAGGTGGTGTTTACACTAGATCCACTCAAATAAAGAAATCCCTCGACCACATCGGCTAAACTATCGGGGCA
TCTTAGATGTTCCCTCTTGGGTTCTCTCAAACCTTGAAGCACACACCTTGTAGGCGCTCTAAAATATATCTATAGTATAATTACACACTCTCTCTCTCTC
ATCGGTCCTCGTCAGACCCATCCTCTGATGTCCACGGGTCTTGAGCCGCATAATTGCTCGCTCCAGGAAATTGCCACAGCTCCAGCTTCGCTGCTAAGCT
AGGGAACTCGTCTGCAATCTTCGTTACCACCTGCAGGTACACGAGCTGGTTGCCCGAAATGTTGAAATGCAGACCGTCGGACGTCAGCAGCAGCGCGTCC
CGCGTCGACTCGTTCATGGCGTTGAAGTACGAGTTCAAGTCAAGCACTGGGACCCCGATACTGGCGCCCGTTTCCACGCACGCTTGAGCGTATTTCTTGG
CCATGGCGTTCGTGCGGTCGATGGTGCCGTTTTGCTCTTTGGCCATTTCGGCTCTGGCGCTGTCGTTGACATGCGGCGGCGTGATGAGCAAAATATCCGC
GGTGGGTGCCGCCCTCCAGAAGCCGCTCACGATTTTCTTCAAATTGTCCTTGTAGGCTTCAATGGGGACGTGCGTCTCCGAGTCGTAGCCGGTTGCCAGT
GCAGCGTCGTTGGCGCCGAACCAAATGGTGATGAGGGACGGAGTCGTGTACACGCGCTTCCTGATTTCGCGCTCGATGGTCGGCGCAATGTACTTGAGGA
ACCATTTCGTGTTGTAGCCCGGGAGTCCTCGCGTGACGACGTCGGCAGTGCGCGAGTATTTGTCCTGCAGCATGGCGGCCCACCCGCTTTTCGCGACGTC
GGTGCCGTGTTGGGTGAGCGAGTCACCCGTGAGCAGGACCACCGGACGGGGATCCGGTTTCGTATCTGCGAGCGCAATGACAGCCAAGCGACGACCGCCG
CCGCAGCGAGGAAGCCGAGCAGGAGGCATTTGGCGCGCAGGGTCAGCAGCATGGTGGTGTGGCTGTCGGGCACGAAATGTGATTGTGGGCGACCGTCGTC
TCTGCGCGTCGGAAGATCCATGATGATGCACGAAGCAGGGCAAGTGTCCGGTCAAGTCATAATCTGCGACGGATTTCCAGCGTATGAAGGAGAGTACGAG
TGAAATGGATAAGCGGATTCTCAATGATCCGTTAGTGTGCTTGGCAGCCCAGCCTTGGCTCATCAGGACGTCCGTGGTGCGGGGCAACATGAATTGTACA
TGTAGCGGTGAAAATGGTGCTTTGGAGGCATCCTGTGGCGTGTCGCGTACAGTGTACTGTTGGGGCGTAAACGTTGGATGTTTCTGGTGGTCAAATCCCT
GAGGCGAGGCCTGAGTTCAGTCAAGCAACGCTAACCAATGCTCGGTTCGTCGGCCCAACAAACCGCGCATTTGCTGCCGGCAGCTTGACTGTTTCGTTAG
AGCCGCAGTAGCACTGATATATGGGCTTTCAGTGTTTTACTCCCTGAATGTCAAGGCAAGTGGTAAGGATGAATACAATAGTAAGGATGAAGCGACACAG
TCCATTCGACTGAGCGGGGGGGGGGCAGATTTGCTCTTGCTTCTGCGAAACCTTACGATCATTTTCGTCACCAGCAGGCCCGCACTGCAGGCAGATCTCA
AACTCCTTTTCGATATGACCGTAACCTTCCTAAATGATTTGATACCAGCTCAGTATGATATAATCCAGAATCTAGTACAAAAAGAGCCAGATTTTGTGTG
TTAAAATTATATCTCATACAGAACCGGCACTTTAGTACGGATAAAATCTTACTTTAATCGCAAAAGTCCGTACATTATCCTAGATATTGTTGGGATATTA
CGTCCTACGCATATCTAAAAAAACACAACTGAAAAGCAGCTTCACCTCTCGATCGGCACCACAATGTCACACCTGGGCTGCAAGCTCTCCCCCCGCTCGT
ACATGCTGTAGTAATGCGCGACCGTTCGTGGGCTTCCAGCCCGGGTGCTCCTCGCAGATGGCCTTGATGTCCTTCTTGCCGGTCTGGAGGCTGGGACTTC
TCTAAAGGGAAAAAATGTGAACTCTACGGTTCACATTTTTGTGGGCCGAGCTTGTCCACGAAGTTCTTGAACTTTTTGGCCGGGTTCTCATCGCCCAACA
CGTCCGGGTCGACAAGTTGCCGCAGTCCGTCCGACACGAGGTTGAACTGCGGCTTAAATTCCACGGCGTACGGCTCGATGATACTTTTACGTCGTCGTGG
CCGCCGTCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCGTCCAGCTCGTCGTACGTGCGCTTGGTGGCCTCCATGAACTTCTGGATACGGAAGTT
GCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGAGACTGCACCAGCTCCGTGTCCACGATGTTGATGCCGATCTCCGTGTCGCTCGTCATGCTGCGGCGG
TTCCAGTTGGCCGAGCCCAGGGACACGTACACGTCGTCCACGATCACCAGCTTGCTGTGGATGTACAGCTCCTTGGACTCCTTGGTCGAGTACAGCTTGA
ACTTGTCCGGGTACGCTTCCTGGATGGGAGATACCATGTCGTACAGGTACTTGGCGTAACCCGTGTACTCGGCTTCAACAGTGCGCTGCATGATCACGAT
GAGGCGCTCAATGCTGGGCATCATGTCCATGATGGCCTCCAGCAGCTCCGGCACGAGAATGAAGTACTGGTCCTGGATGAAGATGTAGTTCTGCGCGTTC
CGGATCGCCTTGATGCGTGCGTGGAAGATGGACTGCTCGCCCTGCGGCGCGAAGCCGTAGTGTTCGTAGTCTGGGCTGAAGGTGCGGCATAGCTGCACGG
CGTGCGTTCCATCTTGGGGAATTTCCAAGGGAACGTCAGATTCATCGATAGGGGCAATTTCGAGTAGTCTGGGTTCTCGAAGTCAAGCACGTCGTCAACT
AGATCCTGTGACGGCTTGGGATCGGCATTCCACCGGTCCAAAAAGTTGGCCGCAACGTCCTTGGAGGCCGGACCCACAACGCGAGCATGAGCGTCCAACC
AGCCGTTCCACAGACACTTGATGCCCGTCCGTTCACGCAGCTCGGCCTGTCGTGCTCGACTGTGTCCCAGCGGTCGTTGGTCAGATCCACGCCGCCCACG
TAGGCCACGAGGTCATGGCCTCTACGGACAATCACCGACTTCTGGTGGTGCGACGATGTGGGGAACGGCAGGCGATCATCGTACACGAAGCGCGCAGGTC
CGTACTGTTCGGGTGGAGGCAGCGCGTTGATGAGGTCGCGCACCTCGTGGTTCTGCGCACGCTCCGTGAGATTGGACCACACGAGCATGCGCCAGTCAGC
GCCGCGCTTCACGGCACCCTCCGCTAGGTCGCAGAGTTTGGTATCAGGCTCGAGCGGCTTGAACGGCACGTTGCATGTGCCCCAGCCCGCGAGGTACACG
AGGTCTCCGCGGCGCACCTCCATCATATCGTTGGCCACGTCATTGAAGTAACCAGCAGAGGCGACGTAGAGCTTGACGCGGTTACCGGTCGAGTAGAGCT
GAATGCCGTCACGCTGATGACCAGCACGGGACGTGAGCATTTCGCCTTCAGTGAGAAACCAGCGCGTGGGCTCGAGGTAGGGCTGGTCGAAGGGCGCGGT
GGCATCTTTCTCGGCTTTTGCTTGAGTGGAACGGGTCGACGATGAACTCGAAGGCGCGGCTCAATCCTTCGGTAAGCTCAGTGAAAGGCGAGGACGACAT
GGTGCTGCTGTCGCGGTTGCGTTAGAGGCGGCGGAATGCGAAATGAAGGAGACTTCCGGCCACCCGGTCGGGCTAATGAGGATTACTACCATCGCGTCGG
AGTTGATCGCCAAGGCTGCCATAATAAAAGATCATCTGCGTGAAAATCAGGTTGGCTTGAAAGTGTTGATTGCCACAGCATGCTTGTCTCTCACCGCCAA
GCACAATCCCATGATCTCTCCGATTCTCACACGTCACAATATACGAACAACCATGTTGGAACTTCATGCATCTGCCTTCCAGGGGTCTTCTATAGCCCAG
GCACTAGCTTCAGGGAGCTGCCACTCTTGCATCGCCTTGTCTAAAGCAGGAAACTGCGCTTTAATGGCATTTCGAATCTGCTCGTCCGCGATCTTGTGGC
CATCGGCGTTTAGATGCAGACCATCCTCCAGGAGTAGCGCGTTTCGTGTCGACTCAGGCATCGAGTTGAAGTATACATTCAAATCCAGCACTGGCACATC
GAGAGCCCTACCAGCTTCAAGACACGCTCGAGAATATCTTCTTGCGTTTGCATTCGAGTGGTCCACAAGGCCTCTCCTCGAGTCGTTCCGCTCTGCGGCA
TACTTGATTCTGGCAGTATGTCGACATGGATCGGGGTGATCAGCAGAATGCTCGCATCCGGGGCTGTCCGTTGAAAGCTGCTCACGATCTGGAGTAAATT
CTCCTTGTAGTCCTCGATTGGGACGTGCAGCTCTGGGTTGCTTCCGTCCCACAGCACGGCGTCGTTCGATCCGAGCCAAACGGTGACGAACGATGGAGAC
GTGTAGGCACCACAGTTGATTTCCTCTTGGATAGCAGGCATCGCGTACTTGAGGAACCATTTGCTGTTGTAGCCCGAGAGCCCACGTGCGATGATGTCAG
CTGAGCGTCTGTATCGAAATTGCAGCAGCGTAACCCATCCACCTTTCCCCGGGTCGGTGGCTTTCTCAGTGAGCGAGTCGCCTGTCAGCAGCAGCACTGG
GCGAGGCTTGGACGGTAATTGAGAGGCTTCCGACCTCACGTGTGTAAGAAGATTATGAAGAGAGCGAAGAAGCAATGGAGTGCACGACAGAGAATGCCAT
TGGGTTGCTGACAAAGTCGATAAATGATCGGATACTCGACAGCTCGGTGGAGGACGACGCTTTGACCGGGTTCCATGGGTCGCGCGAGGGCGCTTGGTAT
CTTGGATCTTGTCGAAGCAGATTGCTTGTTGGCATGGGTCTCTCTCTTCCGGACACGGTCAGAGTTGCACATATGCAAGTCGCAGCGTACTGCAAACCAA
AGCGTTTGCAAGAGTTCGCTGTGGAGTTGTTTCGCTCCAGACACGATTTCGTATTGGCGCGTATAGGTATTGCGTGATGCTGGAGCGATTTTTGCAATGC
TGTTGTTTGCAGATCCTCAGAAAGGATACAACATCGCTAGTGCTCAGCATCGAAAGCAGCGACATAAACCGACATCCGTATTCACGTGACGAAGTTGCTG
CACCGCCCTAACGAAAGAGCTGGTACGCTTCACCGTGCACGTATATGCTTGGTGTCCGTGTACCTGCGCGGCTGGTATGGGCGAATACAGTCAGCGCGGG
CTTGTTGAAATTAACAAATGCCCGATCCGCCAGCAAACGCTGATGTGACTCTCACAATGACCAAACCAGGATCTGTGCCGTTGGTCCGGCTCGGCTCCCA
CTTTTCGTTGGTTTCGACGCTTACTCTGGTATTTGCTCTGCATCGCTCAGGGTCTGAGTGTTAACCGTAAAAGAAGCATGCGTCTGCGACTCCAAGTATT
GGCGGCCATCGCCACTCTGTTCGTGAGTGCCCACGCCGCGAGCGACTCGGTTGCGGAGAAAACCTTCACAGTGGTTTCCCCCGACTCTAATGACACGCTA
GAAGGCTTGTACGTCCAATCTGAAGGCCGCAAGTTCCTCATTCTCTACGACGACTCGAACAAGACCGGGAGCGAAGAATCAGCGGAGCATTCAATCGTTG
ACGACGGCTCTTCGTACGAGGGTGAGACTTCGTCTGATGGCTCTGCCGACCAAGAAGAACGGGCGGGGGCAATTCGTGTAGGCACCGTCACGAAGAAGGT
GAAGAAAGTGTTCCCGAAAAGTACAACACTCTCTGGAACAAGGCCCTGTACTACTTGTTCCAAAAGCTCACTCCGAAGAACCGCAGGATTCCACCTTCGT
AACCCTCACGTGAACTGGAAGGTAGACTAGACCTGTAAGCGAAGCTAATTCACGTATTGAATGCTTGGATCTTTCTCTAGTCCTTACAACAAATCACGGG
GGTGACTCAACTTTTGTTTCACGAAACATGGAGACGAATGACAACTGCATATAACACGCCGCCGAAGGATGATTGTTGGTCCAGGGATGACGCCTGGTGG
TCTTCTCTGGCTAGGTTACGCAGGTTAGGCTTCGATACGCCCACTGCGCAGGGAACAGTATGGGTATCACAGCTAACGAGGTACTATTTGGCATCACCCC
TCAACCGGCTCCGAGCTGTCGAAGACAGCCACGAAAACCTGGCATCGAGCCAACTGCGTAGGCCACAACCACATGCTCGTCGGGGACTTGTGACTCAAAT
GGGCCGACGAGCATGTGTCCTCGTGTACAATCACCGAACACGAACAACGAACTAGTGGGGGAGTGCTGGCATCGTCGCCTTACTCCGAAGAATCATAGAT
CAACGCCTCTGCGTACGCAAAGCTAACCTCGCTTACAAGCCTGAAGAGACTGGTGCTATTGAGTAGTATGATATCTCAGCCTGTAAGTTGTGCAACCGGT
GGATCAATCGCCTGCCTGCGTAGTGTGGCTGGAGGATAGGAATCAAACCCAGCGACTGCTGAGGCGTCAAATCAACACAAGTACGCAGATTGACAAGGCT
GCACAAGGAAACACTGGCCTTGAATCGGTCATCGACGCCCTTCTGGTTCGGCGACGGTGATTTACGCGCATAGACCGGTGGAGCTCCGTGCCAAGAGCGT
GCTTGCCCGCGTCCAGGTCGGTATAGCGTGCGGAAATCCAGCAGCGTATGATATCCCAACTCGATGACGGCCGCTTGGCGATTGCCCGCGGAATAGCCCC
CGCCATCCGCCAGCGAGTCGTCTCAAAACAATATGGTGGTCATTTCTGCCGCCGCCTCATAACTGAACCCACATCTCGTCGCCTGCTCCCATTGGCCCAT
ATCCAACATGATTTCCACACGCAAGAGATCTCCCTTCATTCCTGCTTCTGCCGTCTCGAGCTCAAGTGTCCTGCTTCTCTCCTCACTCAGCCATGGACGG
ACTCAGCCGCGCGTTCCACTTCATCGTGGACCCGTTCCAGAAGGAGCACAAGCCCGAGAAGGCGGCCACCGCGCCCTTCGACCAGCCCTTCCTCGAGCCC
TCGCGCTGGTTCCTGACCCGGGAGGAGCTGAGCACGTCGCGCGACGGCTACGAGCGCAGCGGCATGCACGTGTACTCCAAGGGCAACCGCGTCAAGCTGT
ACGCCGCGTCCGCCGGCTACTTCAATGACGTGGCCGACGACATGCTGGACGTGCGCCGCGGCGACCTCGTGTACCTCACGGGCTGGGGCACATGCAACGT
GCCGTTCAAGCCCACGAGCCCGACACGAAGCTCTGCGACCTGGCGGAGGCCGCTGTCAAGCGCGGCGCCGACTGGCGCATGCTCGTGTGGTCCAACGTCA
CGAGCGTGCGCAGAACCACGAGGTGCGCGACCTCATCAACGCGCTGCCGCCGCCGGAACAGTACGGACCTGCGCGCTTCGTGTACGACGACCGCCTGCCG
CACGCCACGTCGTCGCACCACCAGAAGTCGGTGATCGTGCGCAAGGGCCGCGACCTCGTGGCCTACGTGGGCGGCGTGGATCTGACCAACGACCGCTGGG
ACACGCTTGAGCACGACCAGGCCGAGCTGCGTGAACGCACAGGCATCAAGTGTCTGTGGAACGGCTGGCTGGACGCCCACGCAAGGATCGAGGGCCCTGC
TACCAAGGACGTGGCCTGCAACTTCCTGGACCGATGGAACTCGGACGACAAGCCGTCGCAGGACCTCATGGACGACCTGCTTGACTTTGAGAACCCAGAC
TACTCGAAACTCCCGCAGATCGACGACTGTGACACAGCCCTCGACATCCCCGAGGACGGCACTCACGCCGTGCAGCTGTGCCGCACCTTCAGCCCGATAC
GACCACTACGGCTTCGCGCCGCAGGGCGAGCAGTCCATCTTCCACGCACGCATCAAGGCGATCCGAACGCGCAGAACTACATCTTCATCCAGGACCAGTA
CTTCATTCTCGTGCCGGAGCTGCTGGAGGCCATCATGGACATGATGCCCAGCATCGAGCGCCTCATTGTCATTGTGCAGCGCACGGTGGAGGCCGGGTAC
ACTGGTTACGCCAAGTACCTGTACGACATGGTATCTCCCATCCAGAAGGCGTACCCGGACAAGTTCAAGCTGTACTCGACCAAGGAGTCCAAGGAGCTGT
ACATCCACAGCAAGCTGGTGATCGTGGACGACGTGTACGTGTCCCTGGGCTCGGCCAACTGGAACCGCCGCAGCATGACGAGCGACACGGAGATCGGCAT
CAACATCGTGGACACGGAGCTGGTGCAGTCTCCCGACAACATCACGGTGAACAAGCTGGCGCGCAACTTCCGTATCCAGAAGTTCATGGAGGCCACCAAG
CGCACGTACGACGAGCTGGACGCCATGACGTTCCTGGAGGCGTGCGACGCGCTCGAGACGGCGGCGCACGACGATGGCTCCAGCCTTATCGAGCCGTACG
CCGTGTCGGACAGCGCGGCCTTCGACTTTGTGCCGGACGCTCTGCGCCAGATCGTGGACCCGGACGTCGAGGGCGATGACTGAGCGCGCCCCAGACTGTG
ACGTGGTGGATGATGTGTCTGTATAGCTTTGGCTTTTAGTGCTTCCTCTCTCTTGTGTTGAGAGGATAGCCCAATCGTGTTCATCGGGTGCGATTGAGAG
TAAAAAAGAATGAAAACACCGTTTGGATATGCACGTTGAAGGTGTTGAAGTGACGTTGTGCGTGGAATCGTTTGTGAAGACTTGTCAGGGATTTGCTTAC
TGCAGGACGACTACCAGAAGCGTTTGCTTTGTATCTTCCTTCTGGTGCGTCCTGGTCCGCGTGGAGATCGGAGCGCCAGCCTTCGAGTGCTTTTCCGGGG
ACCAACGGCCGATGAGAGCTGCTTTGGACTCCCCACTTCGCACCCTCCCCGGCGTGGCGCTAGCACCCACTTCTGCGCTCAGTCGCCCACAACGGCAACA
AGGGCCAGTTCTTTGGCATCGGAGTTTATGGTGGAGCCGCGAAGCTGTGGCGAGGGAGGCCGAGCCTCCGTTCGAATGAACCAGCTCCGTGCTAAGTGGT
TGCTGACCATCTCGTCATGCGGCTTTCGACATCTTCGTCCGGGACGTCACGGTAATCACCAAACTGCTGCTAAACTTCGCAGTGTAAACACCGCGCTGAG
CTATAGTTGGTGTTTCTCGGTGGCTTCTTCATCTCGCCCTAGTTTTTCTGGCCATTTCGTGTGATCTGGATGAGGGCCTACGTGGGGTGACGTCAAAGCG
GGGGATCAGAAATTCACGCGCCGAATCGCGGAGTCACCGACGATGGGTCCATTTCACCCGGGATTTACGCTCTACTGAATTGATTCAGCGGAGTTCAGTT
TAGCTCTGGAAGCTCCGATCTTATCTATAGCGTAATACTTGGTCGCTGTCCTCCCTTAGACTTTACCCTTCCGGCAAGAGCTCGTCAAGGGTTCTCGAAC
TGTTGGTAAGACTTGACGCTAGTTGAATCCGGCCACTTCAACCAGTGAACGAGGTGGCGGAGTCATTTCTACCGTTTCGCATTCTTGCGTCTCCGCTCAA
TCGCTAAGCGCTCTGCAGGACTCTTCCGGCATGAGCTCAGTGATGACTCGGTCGCCTGTCCTTAGGGGCCTAGCACTGAACTAATTGCAGGGAAACGCGA
GGGCTTTCACCGCTCGTCTTCCCGTTGAAACGCTGGGGAGGTTGGTCAATCCTCGCAGCTTGGTTTCAAGGTCGGCTCGGTTGGAGCGCTGCTGTGGTAA
TTTAACTGCAGACACATTCTCTTTCGCATGCGTTACATGACGCACTGGTCTTTCGGTTCCCGTTGCGAGCAGCACCGGCATGCATGAGGCAGGGGGTGGA
AGATCACCGGCTGCTGACCTCATCCCAGCTTCCGGGCTTGCAGCGTCGACTTTCTTCGTTTCTTCTCGCTCACTTCAAGTTGGCGTCGTTTCGAGTACCC
CCAAAAAATAACCTGCCCCACCTCGACACTACTGCTGGGCACCATGATTGACAGCACCCCCAAGGAGCTCGAAGCCGGCAACTATGACAACCAAACGTCA
CCGACTTTCAAAGGAGACCGCAAGTCCATCGTCGGCGCTTCGATCCCTCAGCTGCTCCTGATCTCCATGCCTCGCATGGCTGTCCGGATGGCGTGGTCAG
CTCAGTGGGCCGCACTTGGACCTTACCTTGGTACCATGATGCCCAAGTACGCCGTGCAACTCGCCCAGATCATCGGCCCTGTTACCGGCATCCTCGTGGC
CCCTGTCGTTGGTGCTTTCAGCGATCGCAGCACGAATAATGGGGTCGACGTCGACCGTTCCTACTGTACGGTGCCGTCACCAGCGCCATTTGCTGGACTG
CCATGGGCTACACCCGTCAGATCGGAGACGTGTTCGGCGACACCGGTAGCGGCAAGAAAGGCGAAGAGACCAACCGATTCTGGACCATCTTCTTTACCAT
TTTCTTCTACGCGTGGATGGACATCACGGTGAACGTTGTGCAGACGCCACTGAACCTCATGATCGCCGACTTCGCCGGTGAACGGCAGACCCTTGGTGCT
GCTCTTGGCCAGGGATGGTCCGCGCTGGGGTCTGTCATGGTTTCCGGGTATATCTACCTGTTTGGAGCGGCTCACCTGTCGTTGCGCTGGTTTCTCTTTA
TGCTCTCGGCCGTGATGGTCTTCACCGTTTCAGTCGCATGCTTCTTCAGCCAGGAGAGGCCACGAGAGAAACTCGATCAAGTGACCGAGTCCGCTTGGCT
GAGCGTCAAGGGTGCCTTCGAATCCATCTACCACGGCTTCAAGAGTCTACCACTCGAGCTGCTCAAGTACTCCGTCGTGGTCTTCTGTGTCATGTACGGC
TTCTCCGCCTACAACGGCAACAAAGGCCAGTATTTCGGCATCGAGGTCTACGGTGGAAGCCCGAAAGGCGCCAACATTTGTGCGCCTGATTGCTCTGATG
CCCAAGACGCGTACAACCGTGGGGTTCGTGTTGCTGGGGGATACGCAGACCTATGGTTTAGTCTAGTAGGCTACGCCTACTCGTGGGTGTTGCCGTGGCT
TGTGAAGCGATTCGGCGCCAAGTGGGTGCTCTCAGTCGCGCTGATCCCTCAGTCCTTGCTCATGGCTATGGCTTTCACCACCACAGTATCAATCGACGTC
ACGATCGTTATCCTCACCACAGTCACGCTGACCACGGTATTCGCGCTCAACGTGCCCGTGATCATTCACGTACTAGGGCACGAGGCTGAGATCGGTGTTT
ATGTTGGAGTGCTCAACGCAGCCAATTGTTCGGACAACTTGTTAACTTCTCCATCGGTGCTGCAGTAGTTGGTACGCCTATGGGGTACAAGCTGCCGGTC
TTCCTTGGTGGGGCTACGAGCTTCCTCGGTATGCTCTTCACTATTTTCCTGCTCAAGATCAAAATGTTTTCCTTGTAAATTGCTGCTGCAGGTCATGGTT
TGAAGACAAATACTTCACGTAGCAAACGTAAAACAATAGCCGCCTTGCATTCTTCTGTGTGAAAATTAATGAGCACCTCGAACTACGGTAGGTAAGCTTA
GAAAAGGAATGAAGAACTAAATACTACTTCCAAGTACGTCTCGAGCGCTATCGTGGCAGTGTGCCACCGCGGGTTTACACTAGGCAATACTGTACAAGTG
CAAAAGCTCAGTTTTCAACTGTACTCTAAAGAGTACCACGTCCGTGTGAAAGGGAAATATGTTGCTATTTTATAAGGCGTCGACTGCGACGCTCACTGCA
CGCTGAACAATATCTGAAAACGAAATGGACTAGATGGCGTGGAAGGGTGCTACCGCTTCCGTCTGGTGGTCACAGCTTACATGGAGTACATCTTCATCTT
GAAGAAGAGCAGGGCCGTAATGAAGCCGAGTGCGCTCATGACACCGCCAAGGAAGACGGGCAGCTTGTAGCCGAGAGAAGTTTCGACCAGCCCGGATCCG
ATAGCGAAGTTCAGCAACTGTCCGAAGCAGTTCGCCGAGTTGAGAGCTCCAACGTAGATCCCGATCTCCTCGTCTTCGCCGAAGACGTGGATGATCACCG
GCACAATGAGCGCGAACCACACTGCCTGCGTGATGCTGGTGATCGCCACGACGAAGACGTTGAAAGTCACGCTGCTCGTCCAGGCCATGATCATCAGGAA
ACTCTGCGGGATGGTCGAGATCGTCAACACCCACTTCACGCCAAACTTGTGCACCAGGAACGGAATCGTCCACGAGTAGATGTAGCCGACGATGTTGAAC
AGCAAATCAGCGCGGCCACCGGCGATGCTGACGCCGTGGTTGTAAGCGTCCTGCTCCGGGGTGCACGGGTCACAGGTGTCGGCGTTCTCGGCCGAGCCGT
TGTACACCTCAAAGCCGAAGAACTGGCCCTTGTTGCCATTGTACGCCGTGTAGCCGTACTGGACGAAGAAGAAGCAGACGCCGTAAATGGCAAGCACACC
GGGGAGCGTGCGAACGCCATGGTACACGGAAGCGAAGGCGTGGGCTATGCGCTTCCAGGTCGACACGGCGTCGACCTTGCTGGGGTCCAGAGGAGTCTCC
TTGCCGAAAATCACAGCAACACTAATGCAGATGAGCATCGTACCCGACAGCATCCACATGAACTCGTGGAGAGTCTTGTGAGCCGCGCCGAAGAACTCAA
TGTAGCCGGCGACAAGAATCGAGCCCAGAGTCGACCAGGCCTGGCCCAGAGCAGCACCGGTGGTTTGGCGATCACCGGCAAAGTCAGCAACGAGCAGCAT
AGCCGGCGTTTGCACGACGTTGACGGTGATGTCCATCCAGAGGTAGAAGAACACGGTGAGGATCGACGTCCAAGAGCGGTCGGTCTTCTCGCCGTCTGCG
CCGTCGCCGTGGTCACCAAGAGCTTCACCCATGTCGCGAGTGTAGCTCATGGCAATCCAGCAGATAATGCTGAGGACGCCAGCAACAACCAGGAAAGGTC
TGCGACGACCGAACTTCGAAGTGCTGCGGTCACTGAGAACGCCGATGCTGGGGCCGACCAGCACACCGACGATGGGGCCGATGAACTGCGTGATCTGCAC
AGCAAAGTTGGGCAGCATCGTCGACAGGTACGGGCCCAGAGCAGCCCACTGAGCCGACCACGCCATGTTGATGGCCATTCGCGGCATTGAGACCGCGAGC
AGCAACCAGATTGGCGGGTGAGAGAGCGGAGTCTGCTCACCGCCGTCTTTGCCAGGCTTGGGAGAGCCTTGAAGTTCGTAGCCTTTCTCGACGTCCGCCA
TCTTGGAGTGGAGCTGGAACCTTGGAGTGGTGTGGGCTCAAGAGCGCAAGTTGTAGAATGAGAAAGACCGAGAAGACCGTGCGGTGGTGCTTTGAGTGGA
TAAACACACCCTTGACGTTGCTGGTTATCTCCACCAGCCCGTACGGTAACCATCCGCTGCAGGCGAAAAAACAGCCATCCCGAGTCCCAGCCGCACGAGC
AGCGACCCACAAAGTGCAAAGCTTCTGCTATTGTGCTTGAGCAGATGGGGAGCGGCTGGTGACTTTGTGACTTTTACACTGCAGTAGATCACCACTCAGT
TGATGCTTCCCAAGACAAACGACTTGCAAGAAGCTTCAGGCGGCGTGTTTGGTGGGGTGTTTACCAAATTCAAAGCACCAGAATGTTTCTATTAGACATG
GTGACCAAGGCTCGTTTTACTGCACCTTGAACCGCGGCTTCGTTTCGTTGACAAAGCGTCCTTGAACTTGTATTTGCTGAAAGGAACTCCCAGCTGATTT
GTCTATTTGCGCCTCCTCTGCCAACAGTGCGCGGTGCTGTGCCAGCACCGCGGTCAAAAGCTGGCACAGATTGGGTCGCTTGTGGTAAAGTTAGTATGCG
TCGCACCAAGATCCTAGTGGTAATGAGGGCGTCAGTTAGTATTAATATGGGCCGCATCAAGATCCTAGGTTGAGAGGTTGCACAGACCGCGAGTGCATGT
ATGTATAATGCATGCATTTCGCATGAATGCAAGTTTTGATAACTTAGTTGATCGATGAAGGTGTCGCCATTTACTTGCCAAACAAACGATGCTCACGTGT
GTCATCTGATTCGTCCTGTTGCTGCAGATTAAAAATCGTGGTGCCACATTGAAGTGAGACCCTGGGCTATGCTCGTTAGTCCGCAGCTGAATTGTCGATT
CCAGCGTTGTGGGCGAGCAGAAACTGGATTCACGCGTGCTCTCGCCCTCTTGAGCAAGCAACTTCAAGCTCTGTTCCCGCCAGCTCTTTAGCTTAAGAAC
ACCCGACAATAAGAACGGTGCAAACTGAACTACGTTGTAATGCTGGGCGATTATGCCATGCTCCAGTTCTTTCGCGGTGCTGGAGCTGGTCGAAAACTTC
AACGGCAATACAGCCTACCGAAACCACGCATCATTGATGTGGGTAGTCGATTAAAGCATCACCCGCAAGTTTACTCCGTCGTCTGGTTATCTACACTTAC
TGCCCTTCAATTCGGCTCGCATACACGTGTGCATGTATGCGCTCCTCTGCATCAATATCATGGTTTCGATACGCATCCACTATACAGCCACTACTACATG
CTGTACATTTTCATCTTGTAGAAAATCAAAATGGTCAGGAAGCCCAGGAAGCTGGCGATACCTCCGACGAACACCGGCAGCTTGTATCCGAGGGACGTTT
GCACTAGCCCCGTGCCAATGGCAAAGTTGAGCAATTGGCCAAAGCAATTTGCAGAGTTTAGAGCCCCAACGAACACGCCTATCTCTTCGTCCTCCCCAAA
GACATGGATAATCACTGGAACGACGAGCGCGAACCACACGGCGTGCGTGATGCCGGTCGTGGCAACGACAAAGACGTCGAACCCAGGGCTGCTGACCCAC
GCCATGGCCGAGTAAAGGATTTGAGGCACCGTTGAAATGGTGAGGACCCACTTCACGCCAATCTTGTGCACCAGGAACGGCATGGCCCAAGCGCACACGT
ACCCCACGACGTTGTAAAGGAGGTCTGCTCGGCCGCCAGCAACGCTAACGCCGTGGTTGTAAGCATCCTGTTCAGCACTGCATGGGTCACAACTGTCTGC
GTTTTCAGACTCTCCGCCGTATACCTCAAGCCCGAAGAATTGGCCCTTGTTGCCGTTGTACGACGTGTAGCCATACTGCGTGAAGAAGAAGGCGACCCAG
TACACTGCAAGGACACCAGGAAGGGTGCGGATCCCGTGATACACCGCAGCGAATGCGTGCTTCACCCGTGAACACGACGACGCTGCTTCCACATCATTCG
GAGATAGCGGTGTTTCCTTCGCGAATACCACAGCGACACTGACGCAGATGAACATGGTCACGGACAGCATTCCCATGAACCAGTGTAGCGTCTTGTAAGC
AGCCCCGAAAAACTCAATGTAGCCTGCAATCAAAATCGCACCCAACGTCGCCCATGCCTGACCAAGAGCTGCGCCCGTAGTCTGGCGGTCTCCTGCAAAA
TCAGCGACCAGAAGCATGGCCGGGGTTTGAACGATGTTCACGGTGATGTCCATCCAGAGGTAGAAAAATACAGTTAGGATTGACGTCCACGTGCGATCGG
TCTCGTCGCCGTCAGTGCCGTCGCCGTGGTCACCCAAGGCTTCGCCCATTTCACGCGTGTATCCCATGGCAATCCAGCAAACGATACTGAGTACTCCAGC
CACGATCAGGAACGGTCGACGTCGACCCATTTTCATGGTACTGCGGTCACTGAAGACGCCCACACTTGGGGCCACGAAGACACCAGCGATAGGACCGATG
AACTGAGTAATTTGCACAGCAAACCGCGGGAGCATCGTCGACAGGTAGGGGCCGAGTGCCGCCCATTGCGCCGCCCAGGCCATTTGAATTGCCATCCGAG
GCATGGAGATGGCCAAGAGCAGCCAAAGTGACGGGTGAGACTGACCGCCATCTTGAACACTGCCGGGCTTGGGCGAAGTGTGGATGTCGTAGCCTTGCTC
GTAGTCCTTC