Description :
From Genome Similarity Track
Location :
Scaffold_177:11725- 14646
Transcript NameFunction/comments
g11990.t1hypothetical protein

Sequence
2921 bases(100 bases per row)
TCCGGAAACTCTTCATTCAGACTAATCGAATCAAAGAATTCATCTCCGTCCGAATCCACGTCGTCCGTCAGAAGTTCTGCGCCTTCCAAACGTTCTTCAA
CCCTTGGTATGACCTCCGACTCCCTTGGATGACATCCGTCGCCAGTATCTTCCGGACGTGGCACTTCCTCAACCTCAGGGTCCTTTTTCAGCTTTACCGT
GTCTTCTGCGATGACTTCATCTGGAAGAGTTTCCTCCACTTTCGGACGTAAGACTCGAGGCAGCTCCTGAAGTTGCACCATGTGAACTTGGTCGCTTCCA
GGAAGCGGTCGAACCAATAGCTTAGCCGGCCATGAGTATTCGGACTTCTGGACGCAAGGTGGTTCAGCGTCCCTCATCATCTGCTCAAATCGTTCAGAAC
GTAAACGCATCTGATTGGATTCGGTATTCTCATAGATGAGAGTCTGCCATTCCTGATACCTTCGGAGACCCGGGCGGACAAAACGTCCTGCCCTTGGGAA
GAAGCCAAACTCGATGATTCGAGCGACCGGCGTCCGAGTGTCAATGCTTAGACACCTTCCGGAAATATTCACCACTTTGATGGCCACAGCCCACGACCTG
GCAGCATAGATGATCTGGGTTACCCATCGGTCTCCCCGACCAGCCCATACCACATCACGTTGTGGATTGCTCTGTCCGTAATGTATCCGGACGATAGCAT
GTTCACCTGGACGCTGGAAAAGCTCTTCACGCGGTCTCACCGGAAGGTCCAAACCTCTGTGGTAATGATCCGCACCACGTCCTGATAGCAACACAGTTTC
TTTATCCGGAAGTTGCACCAATCCTTCTCGTGCGCACAGTCGCACTCCAGCGGAATAAATGAAATTCATTCCAAGCACCTTCACCAATGTTCGCGACCCA
GAGCTCCAAGACATACACAATTCTCGGACCCAAAGTGATTTTCACTTCAGCACTCGCGGTGATGATGGTCGGAACGCCACCCAGTCCAGATACCCGGAGC
TGTTTGCAGAAGCTTAGTTTGAGTTTGAGTCTACGCGCAAGATCCAAACTCACCATGCTTACTGACGCTCCAGAATCCAAAAGGATGTCTGTCCGACAAT
TGTTCACCACTCCGTGAACCATCGCAATCCGTTTCGTGTCATCCGAACAGTGATCTTCCCACCAGCCATATCGTTCGCCTGGTCCCAATCGGAATTCAAC
AGGTACATCCGGATCTTGTACTTCCGGCCGTACACTTTCCGATAGAACTCGTTCAGGACGAAGTTCATCTGAAAGAGGGTCACCACTTTCCGGAGTCACG
GTCATGCATTGATGTTTATCCTGTTTTTGGCGTCTCAACTCCGGACCAACATACACTAGAAGACACATATTGGGGGGTTTCTTCAGCCCGTCGCGTTCTC
GATCCCCATCCAGCGGGCTTACTAGTTTGACGGCTGTTCCCCTGGACCCACCTTCCCTTCCAGAAGTTGCTTCCGGATAGGAGACGGCAGCTCTTTCAGT
GCTCCTTGACGTGCAAGATTCTTGATCGCTTGGAAAGCTTTCCATTCTTCACATTTGCCTTCGTGAAACGGGTTACAAATCGCACACGGACGAGTCCTGC
AGAGGTGTGTCGGATGTCCCATCCGATGGCATCGATCACATTCGATGTCCGACCAACAGTTATCCGTTAGATGTCCAAACTCCTTGCACTTGTCACAGAA
CTTGGACGCGTTCGGACTTCCAAAACGTTGCTGCCGGCGATCCGACTGGAAATTAGCAGTCGGTGGCCGCCATCCGGGATTCTCCATCGCACGAAATACT
GCTTCGGAAAGGTTATCCATGCTCGAACCGGACACGTCCGTGGCATCCACAGTTGGAGTAGTCAGCACACTCGGAACATGTTCTCGACTTGTCACTTCTT
CCACACCTTCCAAAAAATGGACTTGTCTGTCGTGCTCGCCATCCCGGTTATCGTCATTGTGAAGGACGTAGGCTCTTCCGGAACGTTTCGGTCTGAATCG
ATCACGAGGGACATTGTCCGCTCGGAAGTCTCTCTTCGGAGGTGGAGTATCGTAGTCGTCGTCTTGATTCATTTCTTCATGCTGCTTCAGGACATATTCC
AGGTCCTTCAGACGACGCAGACGTTGTCCTTGCAAAGTCGTTCGGAGGCGGGAGTCCAGACGTTTCTTCGTGAATACTTTCAGATGGCGCTCACGTTGCT
TGCTCGATGCATCGAACTCGATCCCAGCTTTGTCGGCCACCTTGTTCAGGCGGTAGTAAAATTCCAGCGGGGATTCTGCCTTCTTTTGGATCATCGTGTA
ATAACGTTCCGAATCCGAGGTCTTGTCCTTGCAATACATATTTCGGAACTCCTTCAGGAACTTCTTCCATTTCCGGCGCACGTTGGGATTCAAGTTCGAA
CGCCAGTTCCTAACGGCAGCAGGTAACTTCAGCTTCATCTCATAGATCTTGACCTTATCCGACCAACCGCCTTGAACAGCAAAGCTCTGGAATTGTTCCA
ATCACCGGATACGGGTAGCCAGTGACGCCTTCTCATTGAAATCTTCCAACATGCTGGCATTCACGTACTGTAATGGGGCCACGCTGGCCTACACCGTTGC
CGAGCAAAAGAACTTGTGAAAGGGGGAGACCCATTGTTCTTCGGTGTGGTTCACACTGGTCACCTTAAGTACGAGTACGTACTTCACACGAATTGGTGTG
TGGCACTCGGCAGCACGTTAAGTACGATGGTGTACATCACACTAGGTACGGAGTCGGACTTACCGTAGCGGATCAAATGGGGGCCACCCATTTGGAAGAT
CGTCAGTTTAGACAGGAGTTCAGTATGCAGATAGTTTACAGTAGTTAGAACCTTACAAGTGAGATTAATACAGACAGTTTAACTCTAACCTGGAAGTTCG
CAAGTCGTTTGGTACTCGGTA