Description :
From Genome Similarity Track
Location :
scaffold_16:117235- 138180
Transcript NameFunction/comments
g968.t1 conserved hypothetical protein
g969.t1 hypothetical protein PHYSODRAFT_445056
g970.t1hypothetical protein
g971.t1hypothetical protein
g972.t1hypothetical protein

Sequence
20945 bases(100 bases per row)
ATTATCAAGGTTATCCGTTACACAGTAACAGCAATTACTGTTCGCTTTCGAAATCATGCTGTTGGTCAGTTTGCCACAGTAACAGCTGGGTCAAGTGCTG
CTGACTCGTCAAGGGAAAATTTGCTAGCGTCGCCAACTCCTGGCAGTCGGCAGTATCGTGTCTACCGTGCGTCCATCAGGTGGAAGTCCATCGACTCTTT
CCGTGCCGGTAAGACCATATTTCGTGGGTACCAACCAGCCTCTGTTGTGCCCATGCCATCCCCTCAAGCTGAGGCCATGCCAGTCGCAAGTAACTCTGCA
GCTGAGGCCAGTCTGCACGTCGCCAAGAACTACCGAAGCGAGGCGGCGACCAGCGCGTACGACTCGACCCTGGAGCAGGAGGAAGCGACAGTAATCGACA
CTAACGGAGACGAACAGGAGTGTGCCTCGATTAAGAGCGACGACCGCGTAGAAGCCGAGGTCGAGCCGGAAAGCGGAAAAGAGAGCGAGGAGACTGGAAA
CTTAAAGGAAAACCCGTCGACCGTTGAAATTCAAAAGCAGGAGGAGGTTGTCGACGTGGAAGAGGAAAAACCCGCTGCTACCAAGACCCAGGACGAGCCT
GAACTGGAAACGCCAAGTGACGAGTCGTGGAAAGAAGAGAAGAAGAAGCTTACAGCTCGGCCTGCTACTGCGAGAAGCGCAGAGTCAACTTCTGTCACTC
GCCGTCCGTTCGTTCCGTTGGCATCGAAGAGCTGGCGTGTACGAGCCATGCAGTCAAACACACAGATCACGCGTCTCATGAAGGCGGCGTTACTTCAGAC
GCTACTGCACGCTGTTCGCATAGGATCGGTGGAGGGTGTGAAGGTTGCGATCGAGCGTGGAGTGCAGGTGCAGTACCTGGACAGCCGTCAGCGCAACCTC
GTCATGCTAGCGACTAAGTGTGACACCGATGCTCGTCTACACATCGCAATTATTCTGCTAGATGCCGGTTGTGATATGAACCACAAAGATCAGCTTGGCT
GGAGCTGTCTGCACCACGCTTGGTAAGTTGAATGCTGTGTAGCCTACCGCGATATTACATTGGATACTAACCATTTCTGTTTGAATAATTTAGCGCCAGT
GGAGCGGACGATGTTGCTGCGGAGCTTATTCGTCGCGGGGCCAGTGTCGAGTTTAACCCCTATGGATACGGCCCTGAAGACTTCAACATCCCGAAAGTGG
CACATGCTAAAAGTCTGCTCCAGCACACAGAACAGCTGCAGCACGAGCAAAATGTGTGTGCTGCTTGGGCTTACTTTCGCCGTCAAGCTGAAAAGACTGG
CTACAGCATCAAGTGCAAATCGGTGAGTGGATGACTACCTATTGATGATATTCAGATGAACCATGAGCCTAACTGTGTATTCATTTGCTTCTTGTTCGCA
GAGCTGTGATCTCGGCAAGCCTCTGAAGGTCACGTTCCAAGCACCTCCTGGGCATAGCCCGCTGGACCGTATCCGTGTTGTTGATATGAACTCGGACGTG
GCACTATGGCTACAAGTGTCTAAGACCTTTAGTATTCCTCCCGGTGACGTCGGCACGATCACTTTGGACGTGGAAACACTGGACCATCCATCGCTGTATC
GTATCATGTACGAGAAATACGAGCCAACGCCTATGCAACTACCGGCTGCTGCTGAAAGCAACTTGTGCGTGAAGAACCTGGACACTGGAACTACAGTGTC
TATGGGCAGCGTAAATAACTTGGTTCTGAAGGAGCTCAAGAGCTCTCGATCCGCGAAGAAGTCGAAGCAATTGTCTAGCTCGGCCAGGTGAGCAGCTATA
GTTTTGCTTGTATTTCATACGGTGTGTACGTGTATTTACGAGCGCTGTGATATTTCTTTATAGGCCAGCTCCTAAATCCGACAAGGCTGCAAGTGTCGCG
CGAAGAGGATCCACAACGTACGTTTTTGTTGTAATTATGTGCTGGATACTTTGCACTAGAAGTGCTAATTGCTATTGCTCACGATGTGATTCCAGTCGAG
CTCGGGAGATTACGGAGTGCGTGTCTGAAGCCACAGAGGAAGAGGATGAAGAAGGAGCGGCTGAGTTTTCAGCTGATGAAACGATTACGACCCAGGAGGT
GGCTGAGCACCCGGCAGTCACGAGTATTACTGGTGTCTATAAGATCGTAGCAATGGGAGTTGTCAGTGTTTCAACGCTGCGAACTGCCAAGGCAAACGAG
TACGAAATAACCATTCGTCACAAGGGCCCTCTTGGCCTCCAGCTGGTACGTTTTGTCGATCATAACTGTATTGACCTGTCCATTCCTAGCGTTGCTGTAT
TGCTGTTTGTAGGCGCCAAAGATTGAGAGCTTGAAGCGATCTCCGCGTCTCATCGTGCGCCGCAGTCAGGGCCAAGCAGCTGCTGTGAATCCCGGAGATT
GCCTTGTCGCAATCGGCAACGCCAATATCGAGCATGCTGGTCTTAAGCACACGCTGTGGGCGCTGAATGACGCGAAGCGCCCTCTTGTGCTACGCTTCCG
ACGCGGCAATGCCAAGGAGAAGAAGAGTCTGTTCAAGGCTGGTCTGTCCAAGATCACTGGGCCTCGTAGACAATCTGTCATTGCCGTGTAGTCTTTCAGC
CTCTACCTAGTCTAGTTTTTTTTATTTTTCGGGGTTGAATAGATGAAGGCTATGAGGTCGTAAAGCTGCTGTGAGTTAATTGAGCGTCTGTGTTAAAGCA
AGCTGAGCACTCCACGCTGCTTACAACATTGGGTGTCCTTTGTCTACGTGACAGTACTTGAACGTCCTGTTCTGGCTTGTGCATCGCCGGCATAACGCCC
CGGGCTTGGTCGAAACATCAATAACGTGCAACGGGTGTGTCTGCCCAAAACACAGGAAGTGTTAGCTTGTCAGTCGCGTCCCAACTTCACTTCAGATCGA
TGCACAATAGAACTCACCCTAAAGTGCTCTTCCAAGCCATCTGGATGGACTTCTATGCGTGTTTCAGTTTCAGGATCGTACACGAGTGCAGGATCTGCAA
GAGTACATGTACACGTTAGTACTAAGTACCACATTGTTTTGCAGTGAGTAGATGCGCTTACACTGCTTGCCGTCTCCACGCCAGACATACCAAACTTGTG
CCTCCCACCACGCCGGCTGCGTTGAGCCAGCGTTCTGATACTATTCGTATTGCACCAATAGGACGTATTAGCATGAATCCAAAAACAGTGAACAGTAATA
AGCAACTTACTGCGATCGTTAGCATGGATCCGGGCTTTAACGAGTTCGCCCACGTTTTGACATTCTCCAAGAAATCTGTAGGCGCTTTATTCTCAGCGTA
CTTTTTCGTGAGCTGCCACTCGCCTCCTTTTCCGTTGCCTCTTAGTCGCTGCCATGGGTTGTGTCCGTGGAACGTCCATGTATTTGGCAGTATAATTCGG
TGCGGCTCATTCGGATCCACGCACACGACACCGAACGCCCAGTGTGCGAATTGCTGCCTCATTGGACCAGTCTTATAGCCTGTGTAGTAGACGAAGAGCT
TGTGCACACACGTAAACTGATTGTGCAGCAGCCGCGACCACGACTCGTTCTCCTTTGGCTTCTCCTGTTTGAGCAGTTTTTCCGGTTGCACTTCGGCCAG
GAACTGTCCAATGGCCTGCTTGGCCATGATATCCACATCGCCCTTGAACGCTTTATTGGTCTGTCAACAGGCCACAGCACGTCAGCAATTCAACCGTCAA
TATCTTCGCAAATGGACGCACCATTCCAAGTCTGCCGAGCGCAGGAGGCTCCAGGAAAGCTGCTATATAAAGCTTGACCTCGTAGTTGAGCTGCTGAATG
TTGGTCACGCGCTCGTACTTGTAAGCCTTGTTCTTCGCCGCAGCAGGAACGTCCACTCGGCGCTTTTTAGCGGCGGCTTTGCCAGCCAGGTTCTTCTGGA
AGTACGCGCTCTCCACACGCAGCATACACGAGCAGACATCGCGCCCGTTGCAGCGCCGCGTGTGGCGCACGAGCTTGAGCTCCTCGCGCATCTCCTCCGC
GTTCATCGTGTTCTGGCGTCGCTTTACAGTTGGTGTGGTTCCACACCAGCAGATGAGCCAGAGAACTATGATTCATATGGGTCCAATGCGCCTCGACAGG
TTATGCGCATCAAGAGGATTGGCACAACTCTGAAAATGCTGGGGCTGACGATGCGGCCTGCGCGACCGAGCGAGACGCGGCGCTGGCTGGCGGTAGCTGC
CAAGGCGAAGGCCGTCAGTCGCGTGAGAGGAACACGCGATCTTCTGGCTGAAGACTCGAAGCAGCACCGAGAGGTGATGGACGTGCTGCAGCGCACAGTA
GAGCGCTATGGCTTCCGATCGGTACGGTGCCTTGGTCTGGTGCACTGTCAATGGTAGACTGATGACGAATTATCTTGCAGATCCAGACGCCGCTATTGGA
GTACACAGACTTGTTCTCGCGGTCGCTCGGAGATGGCTCGGATATCGTCATGAAGGTACGTGCTGGAAGAGAACAATGGTGTGGGGAGTTCACTAAAGTG
GTCGTGGTGCAGGAAATGTATACGTTTGAGGACAACTCAGGCAGGAGCGTGACACTGAGACCGGAAGGAACTGCTGGTAAGATGTCGTGGTGCTTTAATA
GATGGACCGTAGCTGACAATTGCTGACGATTCTTTTTACAGGCATTATGCGGGCTCTAGTGAGCAACAACCTGCTTCTCTCACTTCCTCAGAAGGTCTCA
TATTCGGGTAGCATGTTCCGGTGAGTACTAATTGCGATATTCAGGTGGTGGTTGTTGCTAACGCTTTAGCAAACTCTTAGATACGAGCGACCTCAACGCG
GAAGGTACCGGGAGTTCCAGCAGTTTGGTAAGCTGTGCATGGGGTTGCAGTGAGTAATGAAGATGTTCTAATGCAGATCGTGTTTGTATATCAGGCGTGG
AATTTGTCGGCTCCTCTGGCCCATCGGTGGACACAGAGATCATTGCCATGGCTGCTGATGCATTGAGCGTCTTAGACATTGAAGATAAAGTCGTGCTGGA
GTTAAATACTCTCGGGGATAACGAAAGGTAGCTTCGTAACACTTTTCGTCTTGATATACAAGAGTGGCGGTTGAGACTAAATGGTGTGTGCATGTTTATA
TCGTAACAGCCGGGTAAGATATCGTGCTGCGTTGGAAACCTTTTTTTCGAAGTGCAAGGACAAGCTATCATCGGACAGCATCAACCGGTTCGTAGATAAT
GCACCAGTTTGGTCGGCGCTGGGTACACTAACAACCAACTCGTTTCAATCCGCAGTCTTGAACGTGGGAGTGTTCTCCGTATTTTGGACTCGAAGAGTGA
GATCGACCAGAAAATCATTGTTGATGCGCCACAGCTTAGCGACTTTCTCTCGGAAGAAGCCAAAACGGTAACACGATAGGACCCATTGATTTTTGTGTGA
TCAGCGTGGATTAACATTTGCCCTCGTTTCCTACAGCGATTTGGCAATGTTCTTAGCGGCTTAGATGCGTTGGGCATCAGCTATCGACAAAACCCCCGCC
TTGTGAGAGGACTGGTAGGATCTTCGTTTACGTTGTTATCAACTTGAAAAGCGTTGCTTACTATGATTGTGCTGCTGAAATTGACGTTCGACAGGACTAC
TACAGCAACACCGTGTTTGAGTTTGTTGAAAGACCAGTAACAAGCGATGCTGACTCGGAGAAAAGTGTAGGCGGCGGTATTGCGGTGCTCGCTGGGGGTT
GCTACGATGGACTAGCCGAGTCACTTGGAGGACCTGCGACGGCTTGTGTGGGCTGGGCTGCAGGTGTCGACCGGTTGAATCTGCTTCGCGAGATGCCGAA
CGAAACGCCTCTCTCCGTTGCGGTACGTTCAATGTACTAGTAAGATACGGTCATTATCAAAGCCTGATGCTTCTTTTGCTTTGCGAATGTTTATAGGTTG
TTCCTGTGCTTGCTGGCGATGATTCGAACCGGGTACTTCACGAAGCTATGCGTGTCACGCAGGTAGGCTACGTGTATTACTTTCTGAAGTATGCTCTTCG
CCCACAACGCCTGACTTGATCATTTTGTGTTGACTCCATCCCAGACACTCCGTCAGCGTGGTTTGACGGTCCATTTCTGCCACGGGCGTGGCAATATGAA
GAAGCAGATGAAGGTGCTTGAATTTCTTGTTTGGATGTGAGAATGAGTAGAATTTGCTGATTCGCATTATGGCGCAGGCTGCGGGGCGCTACGGCAGCAC
TCACGCTGTAATTCTGGGAGGGGCAGAAATGGAGCAGCAATGCGTGAAAGTGAAGAATCTGGACAAGCGCGAGGAGACGGAAGTGCCAATGAATGAACTG
GGCAATTTTGAGTTCCTTTGAAGCCCGACAACAAGCAATAGACAGCTCTTCAACTTGATCAACCAATCAATAGACAGCTCTTCAACAGGATACTAAAAAA
ACCTTGATGTTAAGGTTTTTCAGCTCGATTTGAACACGTCCAGCAACGATGGAGGATGAGGAGCCCCCCACCCAGGAGCTGCATGAGGAGGAGCGCGAGC
CAGAGCCCCAAGAGCCGCAAGAACTGGAGCTATGGTGCCTGATCGTGGGTATGGTGGGAACCGCCTTTCCTGTTGTCGTCCAGGGAACTGACCGCGTCTG
GGAGCTACAGAAGACGATCAAGAACGAGGCCGTGGAGATTTACGGAGACTTTAACGCAGCTCAATTGAGGGTGTATCTGGCCAGAAAAGACAACAACGAA
TGGCTTACGGCAGAGGAGGTGAAAACTATTGAGAATGGGGATGTTGAACCAGCCAAAGCCTTGCTGGAGAGAGGACATCTAGCATCCATGAGCCAATTGG
CAGGGATCTTCAAGAACCGCATTGCTGATGCCGTCCACATCTTAGTTCAAGCACCCCCAAAGACCGCAGATATACAAGTGGAAGCAGACATCACAGGAAA
AAGGAAACGATCGGAGCAATTGATTGGGGGTACGGAAACTGTTGAAGTTTCATCAGAGGAGTTGAGCCTCCTTTTTGACGTTTTGGGGCAGAGAAAGCAG
GTTCAGGAGAACCTGATTACAACCACAGGTCTGAGTGAATTTTGGAGAGGGTACGGAGGGTTTCCGGTGTCGTATTTCGTGCGGACGGAGGAGAAGGTGC
TATGGAAATTAATCAGGGCGATGATGTCGAAAAGGGATAAACAAGTCGCAATTGTGGGTTCCGCTGGTGTCGGAAAATCGTGTCTCCTCATACTCATTGG
CTTCTACTTGGCGTTTGCTGAAAAACGGAAGGTTTTGATTCTTCGGCGCCTGAATGATTTCTCTGAAACTAGCTCTGTGGTTTTTATTGACGGTGGAAAC
AATACTTGCATTCGAAAGACGAACTTAACGGCATCAAAAGTTGTGGCACTTCCTGGTCGGAAAGAGTTCCAGGGCTCTTTGATACTTGTTGATGGATACT
CCCGACAAGAAGTCGACCAACAGTTTGGTCTCTTCCCATACCAACTGATCGCGTCATCTATCGAGACTGAGTTTGCCAGCAATGAGTCGTCTACTGAAGT
TGTACTGCCAGCATGGAGGTTTGCTGATTTGCTGCAATATGCCGAATCGACGCTCGAAGACTGGAAAAAATCAACGGGTCTGGATCAAGAGAAACGGAAA
GATACGCGTGAACTTGCCAGAATGCAGTACTTTTACAGTGGTGGAAGTCTCTGTGATTTTTGTAAAAAGCGTACAGATGTGAAGAATGCAATGGATGGAA
TTTACAATCGTGTAAGTGTGGCGCAGACAATTGACTTGGAGGTTCAACACAACACCCGAGGAAATCTGCTGGATCGAATTCAGCGGCACTACGTCGTGAA
TCCAAGTGACGAGGAACACTACTGGTTGATTTCTCACTGGAGAATCGAAATCGATGCTGGCTATGCATTTAAACGAATTGGGCGGTTCATGGACGAAGAT
AAACAACTCGGTCTTTACCAGCTCGCTCAAAAGCTCCAAGCTGGATTTGGGGGCGCGGCATTTGAACAGTGTTTCCATGGCGCAGTCAGTCGATCAAGCA
ACATATATCCTGTTCAGATGGTAAATGTCGTGGTGAACTCAGACCCGTCGTCCTCCAATCAGAGATACGACCGACTCATAGTGCGCGGCCGACCTGTTAC
ATGCGAGGGTAATACGGAGGAGGAGAGCTATAGTAAGCTGTCGCAAGTATCGCCTGGAGCTTACTGCTATCTCGATAGTGTAAGTCTCCCTTTTGTGGAA
GCAGTAGTGATGTGCGATGGGGTTCTGAGAGGGAGCAACACTACGGAACCGATCGTGGCCATTATCACCACAACCATCTCCGACGCGAAAACATTCAAAC
CGGAGCTTTGGGCGAGGCTGAACCAGGCACTTGACGCCAACAACAGCATATTGAGCAGTACTCCACGCGTGTTTGTAGTGGTGGGTCCTGATCCCACCAC
ATGCAAGAGATTCACATTGATCAATGCGCCTGCTCCAGATGATTTCATGGTGTGTTGCTACGACCCGTTGACGTTTTCTTGGAGACCTAGTAGAGGGTAG
AATGAACGAGATGTTCGCGGCAACAGTATAAAGAGAACTGTGACTTTTGTTGTTGTATTTGAAGTAGCACAAGTATGCATATTCTAAAAACCTTCGTTAT
ATGCAAGCACAACTCTTACTAGTACTGCAGTACGTAGTATATGTACATGTACATACTCTAGCAGCAGTTCACATACATGTCCATGTATTGTACTTCTTTG
CCCGCCAAAATGTGTGCTGCGCCAAATTGACGCGCGAGCTGCCCGTCTCAGATCCTGGGTGCTCTCCAAGCACTGCTGAGTGGCCGAAAGTCCTTTTGTC
ACAGACGGAAAAGGATCAAAGCGCAGCACGACTGGCGAAGTTGGCATGGATCGTCGTCCTCATTCAGCCTTTTACCTTGTGACTCGCGTCTTGTAGCTGC
ACCGCTTGACTCATGGCTACTTCAACTGGCAAACCAAGTCCACGCGATGTACCGTACGCGCAGCTAGTGACACCAGTGGCATCTAGTAATTCAACGAGTG
AACCGAGGGTGGCACTTTTAATCCAGGACGCATCCAGCGATAAGAACGATGTGAAGCAATACTTGGAGGCGGTTTCTCCCTCCTTCTCATTTCTGGATCT
CTACCGCTTCGCCACGCTCTCCGATCGCATTCTACTTGTGCTTGGCGTGGCCATGGCAGCAGTCAATGGAGCGCTCTTTCCGTGCATTGCTCTGGTGTTC
GGCAAGGCTATCGGAGCATTTGCCCAGGCAGACGGCGGGGTAGATCGTGACAAGTTGAACAGTGCATCGCTTGACTACTTCTTCATCGCCATCGGGTTGT
TCGTGACGGACTACTTCGCGTATCTGCTCTTTTCACTTTCAGCTGAGCGGCAGATGAAAGCTCTTCGGGCCCATGCACTGCAGCACATGCTTTATATGCA
CATTTCGTGGTATGATCTGCATGACCCGCTGCAATTGTCGAGTCGAATTACTGGTGACACAGTGAAGATCAAGGATGGAATGGGACAAAAGCTAGGAGAT
GGCGTCAAGTATGTGTGCCAATTTGTGACGGGCTACATCATCGGTTTGGCCCGCGGCTGGGATATTGCTTTGGTCATGACTTGTATCATTCCTGTGATGG
GGTGGTCGATGACGTACGTGATGAAGAGATGGCGTTCAAGAGCGACTCGTGCGCAACAAGTGTACGCAGAGGCAGGAGCAATAGCTGAGGAGACACTGGG
CTCCATTCGAACGGTTAGCTCCCTTACAGCTGAGAAACGTGCTCTTGACAAGTACAACAAACACACTGCTGAAGTTGAAAAGGAAAGCATCAGACAGAGC
AAAGTACTTGCACTCATGCTAGGGCTATTTCGTGGCTGCGACTGGCTGATGTACGCTGCTGGGTTGTGGTACGGAGGATCTAAAGTGTGGAAAGGAGAGG
CTTCTCCCCAACGAGTCTTTCAATCTCTCATGGGTATTCTCATGGGTATGCGGGCGCTGGGGCTGATTTCGCCGAATCTCACTGCGGTTATCGAGGCGAA
GGGCGCTGCAATTGCGCTTTATGAGCTGTTAGACACTCAATCCCAAATTGATGCGTCTCAAGAAGACCAGGGCATTGTTCCCGCCTCATGTTTAGGTCGA
ATTGAGGTGAGAAATGTCAACTTTGCATACCCAAGTCGACTTGACGCCCCGATTTTGAGAGCCTACAGCGTCACGATTGAAAGCGGGCAGACGGTTGCCT
TTGTAGGCGCAAGCGGGGGCGGAAAAAGCACTATCATTTCGCTTCTGGAGAGATTTTATGATCCTACCAGTGGTTCCATTCTGTTGGACGGGCGAGATTT
AAGGACGCTGAACGTGAGATGGCTGCGGTCTCAGATTGGACTTGTATCGCAGGAGCCTGTGCTTTTTGCAACGACAATCGGAGAAAATATTGCGGCGGGC
CGGACTGACTCCACTCGTACTGATATTGTTGCTGCCGCAAAGAAGGCCAACGCTCACACGTTCATCATGGCGTTACCCCAGAACTATGACACATTGGTTG
GAGAGAAAGGTGTCTCGTTGTCTGGTGGTCAAAAGCAACGGGTAGCGATCGCTCGCGCAATTATCCGCGAACCGAAGATTCTGGTGCTAGACGAAGCTAC
AAGTGCGTTGGACGCCGAGAGTCAGCTGGTGGTGCAAAACGCCTTGAACGATTTGATGGCAGAAACGAGCATGACGACGTTGGCGATAGCCCACCGCCTG
AGTACGATCCGGCACGCCGATAAAATTGCTGTGCTAGCTGATGGCCACGTTGTTGAAGAAGGCCCTCACGACGAGCTCGTAGAACTCGAGCATGGTGTAT
ACCGCAGCTTGTATACGATCCAAGAAACGAAAGAGCAAGAAGAAGCCGAAGCTGCTGCGTTGGCTGAGGCTATGCGGGGACAGCAGGACTACGAATACGA
TGGAGATTTGGATCGAAAAGAGAGCTGCCGGTCCTTGAGAAGCGATGGGACACGAAACAGCGGGCGTGAAAGTGTTATTGGCTTAAGTAACACCACAATG
GAGTGCGATACTCGACACAAGTTCACTGTGTGGGACGCTAATGCTCTTAGTAAACCAGAGCGCGGGTATTTTATCATGGGTATGATCGGATCGGCCATCA
ACGGAGCCTCGTTCCCCGCGTCTGCAGTTCTCCTAAGTCAACTGATAGCGCTCATGACGCTGGATTACGCGAATTACGAGGAATACGACGACGTGTCGTA
CTTGTCAAGTTTGCCTCACAAGGTGGCCGTGTATGGTTGTCTGTATATTGCTGGAGCTTTGCTGATTTGGATTGGACGAGCATGTCAGAGCTACGGGTTT
CAGTACATGGCGGAGAAGCTGACTGCACGACTTCGAGAAATTCATTTTTCGTCTTTGTGCAGACAGAACATTGCCTTTTTCGATGAGAAAGAACATGCCA
CCGGAGCTCTTACAGCTGACCTAGCGACGGACGCACTGCGCGTTTCAGTGATATCCGGCGAGTCTCAAGGTCGCCTCTTTCAAGCCATTTTTACGACAGC
AGCAGCACTGCTAATCTCGTTTTTGGCGGGTAGCTGGCTACTGACACTGGTGATGCTTGCCATCATCCCGTTTTTGATTCTCGGAAATGTATTCCGTTCA
AAGAATACGCGTGGCAGCAGCATTCTCGCGGACGATATGGCTGATGTTGGAGCTCATGCCTCGGAGGTCCTTGGTAACATTCGCACCGTGGTGTCGCTCG
GATTGGAGAAGTCTTCGTGTGAAAAGTTTTCAGTGTTACTGGACGAGCCACTGAAAAGTGGCGAGCGGGATGCACAAGTGAACGGACTGGCTGTTGGCTT
CAGCTCCTTCATTGTCTTCGCGACGTACGCGTTCGTGTTTTGGTACGGCGGGAAACTGGTGAATGACGGCTCGATCACATTTTTGCAGCTGATGCGTTCG
TTGATGGCCATTATCATGTCGTCGCAAACTGTGGGGGCCTCTGTGGGCTACATTGCAGATGCAGACAGCGCGTTTGAGGCAGGAGGTGTGATACTTTCGC
TTCGGGACCGGCAACTATCTATTGATTCGTTCCAAGACGACGGTCTGCAACCAGATACTGTTCAGGGCAAAATTGAGTTTAGAGACATTTTGTTCCAGTA
CCCGACGAGACCCGAGGTGACTGTGCTGAAAAATTACAGCCTCACTATTGAAGCTGGTGAGACTGTGGCCTTTTGCGGTCCTAGCGGGGGTGGAAAGAGC
ACATGCGTTGCGCTACTGGAGCGGTTCTACGACCCTATTGGCGGCCAGGTGTTGCTGGATGGGGTGGACTTGAAGCGGCTCAACGTCCGGTGGTTGCGCG
GGCAGCTCGGTCTTGTCGGCCAGGAGCCAACACTGTTCATTGGCACGATCGCAGAGAACATCGCGTATGGCTTGGACGAAATGCCAAGCATGGAGGACAT
CGAGGCAGTGGCAAAGATGGCGAATGCGCACGACTTCATCACGCAGTTCCCGGATGGCTACGATACGCAGGTTGGCATGAAAGGCGAGCAACTTTCGGGG
GGTCAGAAGCAACGAATCGCGATCGCTCGTGCCATGATGAAGAACCCCAGTATCTTGTTGCTGGACGAGGCTACAAGTGCACTCGACCTCGAAAGCGAAA
AGGTTGTGCAGGAGGCACTGGACAAAGTGATGGCAATGCAGCGGCGCACGACCATCGTCATTGCGCACCGTTTGTCCACGATTCGGCATGCGGACAAGAT
CTGCGTCGTGAGTGGGGGAAAGATCGCAGAGCAGGGCACGCACCAGGAGCTGGTCGGCCGTCATGGAATCTACGCGAAGCTGGTGGAAACAGCTTCTTCG
TAGGGTAATGTAGGGCAACCAAGTCGTTTTTGTGTTCATGGTATCTTTGAACGACATCTTACGTATGGATAGTAACGTGTATGTAGCTTTCTACTGTTGC
GATTCTCCATCCATCGATTTCTTCGTTGCTAACATCTATACATCGTTTGAGACCGCTACGAGCGCATATCTTCTCGTGCTTGCTACAAGTAAAACGATTC
AGAAATTCTGACTTGGTGTCAGCATTTTTTTCGGTGAGATAACAGCGCGCGACTACCAATAACAGTTGGCTAAAACGACCGCCCTGTAATCATTGGGCGT
TGCAAACTTTGCACTGCAAAGAGCACTTGCTGCTTGAAGTCCTCGCATGGGGGCATTGCCGCTCTCCACCCGACTCAACTAAGTAGTGTAAAAAGTCAAA
TCCATAATACTCAACTCTCAAGCTCGTTCACAACTGATACTCTATCGCCTTGCCTCCACCGTACTGATATAAGGCGAGCTTTGCTTGACATGTTGACACC
ATATATTAACGCAGGAAGTATGTAGAACATCGTGATGTTCGTATCTGCCATCGCACTTAAGTCGAGGGAGGCACCAATTCATTACTGAATCGTTGCTTAC
AAATATCAAGTGTACATTATGTACACCACACCATTCCTTCCGTCGACTGTCGGCGCCATTTCCGTTCTGGCTGGAGCAAACACGCGCGAGAAGAGCGCTC
TATTTGCCTGTCTGTAGTTGCTGTCCGCCGGACATTGGCCAACCGTTCCTGTTGTTGCTGATTCAACTGCGTGACCAACAGCTCAAACCATGGAGAGTGG
TGTTCCTGATGCACGTACGTCCTCCACAGCGGAACTAGCAGTTGTGCCTCGTCCTGCGTCTTTTGTGTGTGCAACTGGTGTCTGTACACGACTCTAACAA
TGAATCTGTTGTCACTATTGTTTATCTGCAGCGGCTGCGCCCTCTAGTCAGCAGGAACAGCCTCCAACACCGACCCCAGTGCCCGTCGAAACACCTAGGG
CGATAAGTACGGCAGCAGAGCCAGGGATGCCTCCTGTAAGTACTGTTGAAGCAGCCAAGGAAGAGGTGAAGTCAAACAGCCAGGCAAAGGGCGATGACAG
CGGCGACCGTCGTAAACGCCGCTCAAGCAAGAAAGTAAAGTATGTGGAGGAGGAGGACGTCTCCGAGGGCGAGGAGGCTATTGTTGCAGAGAAGAAGAAG
CGTGCACAGCAACTTGACTACCAGCTGAGAGCAGTACGTGACTGAGCTGATATTGCACCATGAAGATTGATTCTGGTACTGATTTTTTTTGCTACTTGAT
TAGGATGTGGGCTACCCTCAATTGGACCAAATTGTGGGACGACGAGTCAATGAGTCAACGGGACTTGTCGAGTATTTGTGCAAGTTCCTTGGTCGTTCCT
ACTTGCATTTGTACTGGCTTACGTTTGATGAACTGGAGCTGTTTATTCCGGAAGGTTACCAGAAATTCCATCGCGTCCATGTGTACGACCGAAAGCTACG
ACGCGAGGGATATCAACCACTTGATGAGGTGGACGATCTGGAGGCGAACAAGCTGACTGTGGAGAAAATCTTGAACCACAAGGTGGATCCTGCTGACCAT
TTGGACGAGCAGATCGAAAAGCGCCGACGTCAACTGCCATTTGAGCCCAAATTTCCGCGTGTGACGGACTATTTCTTGATGGACAACGCCGATGCTGTAC
CGGAGCGCATGTTGGGTATTGTCACAAAGCTGGGAAAAGAGCCCGGAGGAGACATCTTTGAACACCCTGTTGATGTTGAGGAGGTTCCGGACTACCTCAA
TTTTATTACGAACCCTATGGATCTCGGAACGATATCCACACGACTTGGTCGGGAGAGCTACTACGTGGGGCCGTCCGCCGTGTCGTTATTTGCCTCAGAC
GTACGGCTGGTGTTCCAAAACTGCAAGACGTACAATGCAGAAGGTTCTGACATCTGGCGTATTGCGGATGCGCTACTTCGCACTTTCGATAAGTGGTTTT
ACGACTGGGTTTTGTCCCCGTCAGCATGGCTAAAGCTCCCCCCTTCAGGGGATGCAGAGGAAGACCAGCGCCTCCAGAAAGAGTTTCGTACTGATGCAGA
AGGTTTCTACGATGTGTGGGCGCCTTGGCAGATTGGCTGCTGTGTGTGCGGAAATAACAATCATAGTGAGGAGCTCCTGCTGTGTGACCGATGCGATGGA
GAGGTCCACATGCACTGCGCCACACCGAAAGTATCTGAACTACCGGAAGGCGAGTGGTTCTGCGGATATTGCCGGGCCCGTGCAAAATATAGCGAGAAGA
CGAAGAAGGCAAAACAGGACCACGACAACAACAACGCGATGACTATCGATACAGACACAAAAGCTGCTGTGGCGTCTGGTTCTACTCCTAAAGGTACCTC
TGCAGACAAGAAAATTGTTACCACATCCACGCACGCACCCAACGTCCTGATGGAACGTGTTGATGGCGAAGGTAAAGTTAACAAGAAGACGTCAAAACGG
AGCCCTATAGGTCTACACACAACGAAGAGTTTGGCTCCAATCAGCATGAAAGATCGCGCTGCTACTTTTTTCCTGGTCAAGTGGGTTGGTATGTCGGTCC
GATTCTCTACTTGGGAACGCCCCGAGGACATTGGTGATGACGAACAGATCCAGAGATATTTCAAGTTCAGCCGTGTGCCCAGCGCCAAGGAGATTAGTGA
AACTACGTGCCAGTTGCCGTGTTGTGCTAAGCGACACCAGTACGCGCTAGCAACAAGCACAGGTGGGAAAAGGTGCTGCGAAAAAGACCGCTTTTGCACT
CTTGGGTTCGGCCACGAGGGTGATTGCAGCCGAAGTATTAAAGCCTTGGGAGGGCCTTACGGCAGCAATGCGTATCAGCGACTGCACATGCAAGAGCAGG
TTAAGGCACAATTGTTCGCCTTTCATTGCTTGCTGAACAATCACACGCCGGACAAAGATGTACTCAAACAGTGTGGTATGTACACTAGCTCATTCGTGAC
TGCTAAACAGTATCTGGCGCCGAAGGTTGCCAAAGAGGACGAAGACGAAGATTACTCAGATGATGGAGACTCGTCTGATGATGATGCCGACTTTGATGCA
GAAACGGATTATTTGAATCGACCGGCGCTCTACCCAGGAATCTTGACGCTAGAGACTGATGATGATGAAGACGATGATGATGAGACTGGAGGGCACAAAA
AGAAAACAGAAGAAGAGGTCGGCGAAGTGCTTAGTTCCCTCGTTGAGCACGTTGCTCTCGGATACCCTACCAAGCTGGAAACTGTCAGCGCTAAGTTTCG
TTTTGATTCGACGTACCCAGCGACAGCTTTCAGTGAGCTACCTGCCTTCACGGAGTACTGCGTCATTCTAGGTCGATCGCCTTTTGGTTTAGGAATGCGT
CTTGGAATTAGCAGTTCCAGCTGCGTATCGGTTTTGGGATTCCAAATGCTTGCGAATGGCATGATTGGTCCCGCCCAGGCGTCTGGCGCTATTGCGAGTG
GCGATGTGCTTGTAGCTGTGAACAACATATCGGTGGCGGGTCTTTCGTTCCAAGACGTTGTTGGATTGATCGGTGCATCCCCCCATCAGATTCTTTTCCA
CTTCCATTCCCCCCGGCCAGCGTTCATGTACCCTCCGTACTGCCAAGCAAAGCAGATCACGAAGATTCGCTTGGAAAAAATTCCCGATGATGCGGTTCCT
GATGGCTCCAAGTATGCAGACTTCAGTTACAACAAGTTCAAGCGAATACTTAAAGTGGGAGTTGCAGACCCAGATGTGGCGGCGTCAGCTTCGACGGAGA
CGTTGATGCAGCACGCGAACTACATTTCTCCTAGCGGTCCAATGCAACATCTTTACGCAGGGGTCGTCGACAACAGCATCGACCCACACGAGCATTTCGC
GAGCTTTCTTCCGGTGCGGAGTACGGCTACCAATGGATCGCACACCAAAAAGGAAGGTGGAAGTGGTCATGGAGATTCGAATGAGTTTGTGCCGTATGAA
CAGTCACCAACATACAAAGGTGGCCGCACTCTACGTGCATACCAGGTTGAAGGTCTAAACTGGATGGTTTCATGTATCAAAGCTCAGCGCTCGTGCATAT
TGGCTGACGAAATGGGGCTGGGTAAGACGGTTCAGATTGTTTCACTGATTGAACACATGAAGTCAGAGGAGTCCATCCGGGGGCCGTACCTGATTGTCGT
CCCCCTTTCTACTATTCAGCATTGGCGACGTGAGATTGAGAGCTGGACAGATCTCAATGTGTGTGTGTATCACGATATTGGTGACCGCACCACCAAGTTT
ACGGCTAAAGATATGCGCGCAGTCATCCGAAACCAGGAATGGTATTATCCAGGCTTGGGCAACTCAATCTTCAAGTTCCACATCCTGCTGACCACGTATG
AGACCATTTTGGCGGATTTCGAAGAGTTCGAGCACATTCACTGGCGCTTAGTCGTAGTTGACGAGGCGCATCGACTGAAAAGTGCAGGGTCACGTGTGCT
GAAGATGATGCGGGTTCTCCATGTCGACCGCAAGGTATTGCTGACGGGTACGCCTCTGCAGAACAACACTCAGGAACTCTGGGTCTTGCTGAATTACTTG
GAGCCGGTGAAGTTCGCAAGCTTGGAAGAGTTCAACGCGAACTTCGGGCAGTTGCATTCGCAGGAGCAAGTCGTGAGGCTGCAGCAATTGCTGGCACCGT
ACATTTTGCGACGCGTGAAGGAGGATGTTGAGAAAAGTATCCCACCAAAGGAAGAAACGATTATTTCCGTGGAGCTAACAACGCTGCAGAAGCAGTACTA
TCGAGCCATCTACGACAAAAATAAGAGCTTCCTGTATCGAGGCACGAAGAACGGTTTACCGACGCTGAATAACATTCAGCTCCAGTTGCGAAAATGCTGC
AATCATCCATTCCTGATTAAGGGCGTTGAAGAACGAGAACTGGATGAACTTAGTAGCAACCCTACACCTGTCCAAATCATGGAGAAAACGATCGAGTGTT
CAGGCAAAATGATGCTGGTGTCCAAACTGATTCCGAAGCTGAAGCGAGATGGACACAAGATTTTGATCTTCAGCCAATTTCTCAAGCAACTTGACTTACT
GGAGCGCTACTGTGAGGCGAACTCTTTTGTTTTCGAACGTTTGGACGGGTCTACTGGTGGGAGTGTGCGTCAGAGCGCGATCGACCGTTTTTCCCGACCC
CACTCGAAGTCGTTTATTTTCTTGCTAAGCACGAAAGCGGGTGGTGTGGGTATCAACCTGATTGCAGCAGACACGGTGATTATATTTGACAGTGATTGGA
ATCCGATGAACGATCTGCAGGCTCAAGCACGTTGCCACCGCATTGGCCAGAAAAAGAGTGTTCAAATCTATCGTCTGGTGACCCGCAACACCTACGAAAG
CGAAATGTTCGACCGTGCCTCACGGAAGCTTGGCCTTGAGCACGCGGTGCTAGGTACAGCATCTTTCAACGAAAACTCTCAGATCACAAAGCCGTCGGCA
GAGCAACTTGTTGAACTGTTGAAGCGCGGAGCGTATGCGCTCATGGAGGACGATGATACAGCGTCGAAGGAATTTGCAGATCGCGATATCGAGACTATTT
TGAAAGAAAATGCCCGGGTCATGGTTGTAGGCGGCGGGTCAAACACAAACAAGGGAGCGGATGGCGATGCCGATGAAATGACATCACCGAGACTCAAGAA
GTCCCCAGTGAAGTCGCATAAGAGGAAGTCACTCGGCGGAATGGCTGTTGACCGTTCATCCTTCGTTGCCGAGGGAGCGACTGGCGAACTATCTGTGGAT
GACCCGAACTTCTGGGAAAAGGTTCTTCCGGGGGCTGTATCAGTGGAGATGCTCAGTTTGAAGCTAGAGGATGGAAGTGCAGTGAACTCACGTCAGTCAA
AGATTAAGTTCATTAGCAATCTGGACATTGCTTTAACTAGCTTGGTCGCTGAGATGAGTACAGGGAATACTCCTGACGATGGCCGCGTTGGAAGTCGAGA
CATTCAGCACGAGTACGATATTGCTATTCAAGTGTTGAGTACTGTGCTGTCGAAATATCGAGATGAGTTCTCCAACGACCAGATCGATCTTGTGAAGGGT
TATCTTTCGAAGCTGGACAAGTCACGCGTGCGAAGTTGCAGATTGACGCCATCTCGAACGAATATGTTCCAGGATGAAGACTTCGATACCCCCAAGAAGA
AACGAAGACGGAAAAGTACCCCTTCAGGCAGCAGGGCAGGGAGTAGCGAGGACGAGGCGTACGGCGACACTCCAGTCAAGAAGAAGAGGGGACGTGGTCG
TCCGCCGAAACACCCGGGAACCAAAGACGCGAAGCCTCCAACTGCCCTTTTCCAAGGCGGTGTCATCAATGATAGTGACGATTTGTGTACTCTTTGTGGT
GACGGTGGATTGATTTTGCTGTGTGACGGTCCGTGCCATCGCTCATTCCATCTCGAGTGTGTGGGCATGAAAGATGAGCCGAACGACGAGCAGTGGCTGT
GTCCCGATTGTGCTGAAGGTCGCCATATGTGCTTGATCTGCAAGCAAGTCGGCGAGATGGGTGTCGAGTTTGGGGTCACGCAATGCTCGGTGGCCAAGTG
CGGTAGATTTTATCACAAGGGGTGTCTGGCCAAGAGCTCGCGCGTCGAGTGGGTTGGCAAGAAACGCTTCCGTTGCCCGAGCCACTTTTGCCATGCCTGC
TCGAAGACAGAGAAGAAGCAAGCATCAGCCAAAAGCAAGAAACAGAACGACAATGCGAGTGTTGTAAGCTGCATTCACTGCTCACAAGCTTTCCACCCAG
ACTGCATCCCGTCCACAGACAAGTTCATTCGGCTTTCTAAGAACCTCATGATATGCGCGAATCACTTGGATGGAAAGAAACCGCGGGCTTCCGCTAGAAC
AGCGACTGTGTCAACACAACGGGCTGGTGCATCGTTAGCTGCAGCAGCAGCTCAGCAACGACTGGAAGTTCCGCAGGATATTCCTTTAGAGGAAGATGAT
GAGGACGATGAAACGGAGAAGTCAAGTAGCAAGCGTAAACGTGCATCATCGCCGAAGAGGAGCGGCTCGAAAAAGACGAAATCTGCGCTTACCGATGGCC
CCCCCGCGAAGACTCCTACAAAAACCAAGGTATGCGCGCTATGTCACCGGGGAAACGTGATGGGAGGAAATGTAGATGGCCAAGAGCTGCCACCTCCGGT
TCCAGCGAAAAATGGAGCACGTAACGGGAGTTCGAATGCAAGTGCAGAGTCGACGGGGACTGCCACTGCCGACATGGCCCTTGAGGGTCCTTTCATCGAG
GCCCCTGTGCGCTTGAAATATGCTGATAAGCCCAGCGAATCTGTGTATGTTCACTTGAACTGCGCTGTGCATTCACCTGAAGTGTACGTAAAGGCCGATG
GTTTGATCATGAACCTGCCCAAGGCAATCAAGCGTGGACGGCAGCTCAAATGCACCAGTTGCCATAAGTTTGGTGCTACGGTGGGCTGTGTCGTGGCCAA
ATGTCGGCGCAATTACCACTTGCGTTGTGCTGTGGAGAGTGGGGGAGAGATCGATGGCACCACGTACGCATTGTATTGCAAGCCGCATGCAGCTGCACGC
AAGGAGCCGACTCGCGTGTGCGTGTGTGATGCCGACAAGGACGACGAGACGCTCACTCTGGTGTGCTCGTCTTGCAGTACGAAGTTTCATCCCAAGTGTG
TGAACATGTCGGACCGCCACGCGGCTCGTATGGCGAAGACGTGGGTCTGCAGTGTGTGCGACGGCTCCGCTGCGTCGGCGCCTTCGACTCCGAATGTCAC
TCGCACGCCCGCCACTAAGATGAAAGCAGGCCCGTCGAGGAAACCACCATCAAAGACCAAGTCAAGCAGCTCGAAGACTTCAGCGAAGGCAACTAACAAG
ACATCGTCGAAAACGAATACCAAAGACGAGGCTGATAGTGCAGACACTAACCAGCCGTCAACCCCGAAACGTAAGAAGGCGAAGAAGAACCGCTTGAGCA
TGCCACGGAACAAGGCTCGTCCGAAGACAAATGGAACCCCCCACGGGATTTCGCCGCACATGGATGCCGACTCGGATAGTGGTGTATCCACGGACGAGTA
GGGTGGAAGGGGAAACAGCACAAATATATGCTAATGGAGCTTACG