Description :
From Genome Similarity Track
Location :
Scaffold_183:11723- 13558
Sequence
1835 bases(100 bases per row)
CGGAACGCGAGGGTGGGTGGGACCGTTTACGTTGAACGGAGTATAGCCTGTAGAGGCATGAACAGCGGTATGCAACGCAAACTCAATAACAGGGAGCATG
GAGCTCCAACGCTCAGGCGTATCAGCGCAAACACTGCGCAAAATGTCATCAATGACGCAATTAACACTCTCAGTTTGACCATCGGTCTGCGGATGATCCG
CTATGGACATGTCCAAACGGGTGCCGAGCACCTTGAAGATGGACTTCAAAAAGTTCCCAGTGAATCAGGGATCTCTATCAGAGACAATTACCACTGACAA
ACCATGTTGTCGAAACACACGGTCGATAAACAGCTTCGCTGTACCTTCTACATCAAATGGGCCCGGCACTGCCGCTAGATGAGCCATCTTGCTCAATCGG
TCAACAAAGGTCACAATGCCAGTGTAGCCTTCCGAATCTTTCGGTAGGCCAAACACACAATCCATACTCATGGGCTCCGAACACCAGTGGGTACAGGTAG
ACTAGCCAGCGCCGCCGCCGCATGTGCTGAGGGTTTCACTCGTTGACACGTTTCACACGTACGCACATAGTTGCTCACCCACTTGCATAGTTTGGGCCAC
TAATAAGCCTGGCTCACTGAGCTATAGGTCTTCTCACGACCGAGATGACCACTTAAAGCGGTATCATGTGACTCATAGAGGATTCGATACTTCAACTCCT
CATCATGAGGGACAGCGATACGAAGGTTATCCTCAATATCTGTGCGATAGCACAACAGGCCATTATCGATAGAATATCGATGTAGCCTCGCTCGTAAACG
TGCCGACAATTCTATGTCCGAGTCTTTAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACAAATTGTTTATCCCTGGCATAAAGCCGCACTGATTAA
GTCAGTGACTGACGATGAAAGCGTAGTGACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCGCATCAGCCAAAGCTTTTTGCTTTCCTGGCTTATAC
TTCACTTTGAAGTTATATTCGGCAAAGAATCAAAGCCAACGAGCCATTCTCAGAGAGAGATGCGGCGACTGTGTCGCAGTGCGCAATGATGAATGATCTG
TACAGATCACAAATGGCTTTGAGGCAAGCAGATGTACTCTGAATTTGACTAGAGCGTACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTT
TTCAGCAGCTTTGAGCTGTCGAAATTCGAATGCAATGACGCGTTCGCATCCATCGACATCGGTTTGTAACAGACCACTGCTTATGGCAAAGTCAGATGCG
TCACAGACGACACTGAAAGGCCGATCAGGATCGGGCAAAGCCAGTATCGGTGCATGAAAGAGACTTTCCTTAACTGCTTGAAAAGCCTCGTGTTCGGTGT
TACCCAACACCAATCCACATTCTTTTTAAGGAGATTGGATAATGGCCAAGCCATATCTGCATAATTCTCACTGTACTTATGCAAGTAATTGGCAAGGCCA
AGCTACTTACGTAGATCTTTTTGGTTCTTTGGAACCGGCCAATCGACTATGACCCTTATCTTGGCGGGGTCCGCTCGAAGGCCTCGCTTCCCAATGAAGC
ACCCCAGAAAGAGAATCTCTTCTGCAACAAATATGCACTTAGATGCATTTGCATAGATTTTATTCGTGCGCATGCACTCGACCACCGCTCGTAAATGATC
AATGTGATTATCCACATCAGATCGACCGTTCGTTGCACGACTATGGACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGATGAGGTCTGAATAGT
GGCGTCACCAGACGATTAAAAGTAGCCGGTGCATT