Description :
From Genome Similarity Track
Location :
Scaffold_152:11722- 14797
Sequence
3075 bases(100 bases per row)
CCAGTAGGCGTGGGGCGCTCTGCTGAGGAAGAATTAGGTTGTGTTGAGCCTCTAGGAGTTTTGAGCAGGACTTATCTCCAAAGGGTTCCTTACACTCTAA
TAGGTGATGGGAATACAACCCAGGCTTGTAAGTCGCGAATCCAGATGTGAGTGCTGTGAGAAGTCCTGGTCGATTTTGATCGACTCCGGTGCATCCAGTA
ACCATGTGAGACGATGTTCCCACGAGGGAATTCGACTGTAGGATGAGGCGCTTCAGGCGCAAAAGGGTGATACAACCCCCTTTCGCTCAGCGACAGGGAC
TTTAGTCACCGTAATCAAAGTTGCTGTGAACTTAGGCGTGAAGTTTTTTGACTTTGACAGTATCGATCGCTGTTTAGTCCTCGAGATATGATCTCATTCT
TGGTATGGCCTGACTTGAGCGCCACGAACCTAGGATTGATTGGAGATCAAAAACATTAGGCGCAACGCGCACTGCACCTAGCGGAGCTTTGGAGAGTCAT
GAACCCACCTCCGCTAGTAATCAGAAGCGCTATTGGCGCAATCCACTGGCTGATTCTGTAAGTGTGCTGGAAATTGAAATGTCGGAACTAGTTGCTTCTG
ATCATGCCAAAGACACCAGTATCGAGCTGAGGTCGTTATTTGATAGTGAAAAGGCACGTACTTCTTTGAGTGATATTCGTTGCAAGAACGACTCACTGGA
CGCTACAAGCATTGTTGACCAAGCGTCACGTCATCGAGGGTTGGACCCATCAGAATAGCGTAGAGTTGCACATATGTACCTACTGAGTGACTTTGGCTGT
GATAGAGACGCGTTGAATGTCAATGTTGACGTTGCTGGTGAAATACCAAGGCATCCCAAGCCCGGCCCAGCGGATGCGCGTGAAGTGGAACGTAATCCAT
GTGATTGAAGACGTCACGTCAAAATACTTGTTATCAGATGCCGGTAGTGACAACAGCTCTAGCTTAGAGCAAATTACGTTTGACAATGATATCGATCAGA
AAGATACGAATCACATAGCGCTGTGTCACAAATTGATGATTACTACCAGCTATATACACTCATCAACGGAGTAACTGGTGTCTGTGAAGGTACGTCTAGC
CTTGAGGATATACCCTCGTTAGGTGCTCTTCTTGAACTCGAAGAATTGTCAGTCGATGAGTTTGGTCACTCACTAAAGAATGAAGATCTTTCAGAGGTTG
TGGTCATTCGACCCGACATCATAGAGTTGAACTCTTCTTCACTTTTGGATGAAGTCGTTCTGGAAGACACAAAAGCGGTACTCAGTGCGCTTAGTGGGTC
ATCAATGTTGAAAAACCTTTATGATCCTTTTTATCCTTTATTCAAGGAATTTCAAGATGTGGTGTGCCGCGACCCACCCTCTGTTCTACCTCCAGATGTA
GGTGTCCGTCATGAAATTGACTTAGTTCCTGGTATTAAATGCTGTATCACACTACAGTTGCCGTTGCCTATAGAGCAATGTGATGCCATTGATGACTTCT
TCCGTGCCAAACACGAGGCAGCAATGGTACGTGAAGATAAATCTCCACATTCGACACCGAAATTTTGTGTCAAAAGCCGAACAGCAAGTGGCGTATTGTG
CATGCTTATACCAAGCTTAATGCGGTTACTATTCCGGAACAGACCCATTTATCGAAAGAATATTCTTTAAAACAATATAGTTGGTTGTAATATGTGTAGT
GCACTCGACTTAGTCGATGTCTATAACCAATTGCTCATGCGATCGCGTGATATTCCGCTCAGCGGTAAGCACTCCTAGTGGTATGCTCTGGATATGGCTG
GTGATGCCGCAAGGGCTGTCGAATGCGCTGGCTAAGTTTAATCGTCTGGTGACGCAACTTTCCGCCCCCATCGGGATTATGCACAGACATACTTTGATGA
AATTTTTGTCCATAGTTGTGCCGAACAAGGTCGTTTGGATGTTGACAATCACGTCGGGCCCCGTGCGAGCCGTGCTCGACTGTATGCGCACGAATAAACT
GTACGCCAGTGTATCTAATTGCATCTTTGTGCAGAGGAGATTCTTTTTATAGGATATTCATCGGTAAGCGCGGTCTCAGAGCGGATACCGCTAAGGTCAA
GGCTATAGTTGAAGAAACAGTTCCTAATAATCAAAAGGACTTACGTAAGTGGCTTGGGCTTGCCAATTACTTACACAAATATAGCGATAATTACGCTGAT
CTGGCTCGGCCATTAGCTAATTTCCTTGAGAAGCACGCATATTGGCGCTGGGATAGCATCCATTTGGACGCATTTCGAGTAGTCAAGGTGAGTCTCCTCC
ATGCCCTCATTTTGGCGTTACCAAATTCTGAGTGCATTCTGTGACGCATCCGACTTTGCCTTAGGCAGCGCCCTGTTGCCGAAGGCCGCGAGCTTGTTGT
AGAATTGAAATCTCGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGTTCATAAAAAAGTGTTACTTGCCATGAAGTATGCTCTCTTCAATTTAGAGCTC
ATTTACTTGGCTTCAAGCCTTTCGTCGTCTACACGGATCATCCGTCATCACGCACGCGACACAGTCGCCTCACCTATCTCAAAGAAATGCTCGTTGTATA
TCCTTCTTTACAGAATATAACTTCGAGGTGAAGTATAAACCGGGCAAACAGAATGTGCTAGCATATGAACTCCTTCGCCGACCTGACAATGAGATCGCTC
ATGTTACGAATCTGTCGTCGCCTATTGAGGATTTAATCCGTGTGGCCTATTCACAAGATTCTCAATGTGTGGCATTGTTCTATGCACTTGGAAGTGGCGA
GTACAAAGACTCGGACAGCTCTTTGTCGGCACTGTTACGTGCCAGCCTTCATCGATGTTCCATCGATGGTGGCCTATTGTGTATTGAAAGTATCGAATCC
TCTTTAAGGTACATGATACTGCTCTCAGTGGGCATTTGGGCCGCGAAAGATTTACGGCTCTGTGAGTCAACACTATTGTCGGCCTAAGCATTAGAAATGG
GTAAGCACGTATGTGCGTACATGCAAAACGTGCCAGAGGGCTAAACCCTCGGCACTTTCGACTGCGCTCGCTAGT