Description :
From Genome Similarity Track
Location :
Scaffold_1025:11722- 13784
Transcript NameFunction/comments
Phypl_g12106hypothetical protein PHYSODRAFT_494903

Sequence
2062 bases(100 bases per row)
TGAAGGTGAACAACTACCCGCTGCCGTACACGGAAGCTGCGAAGGCAGTGCTGAACTCCAACTCCTCATTCACCGCGGCTCTCTTCATCTGTATCGCGTT
TACGTTTCTGCCGGCGTCCATTGTGGTCTTCCTcgtcaaggagaagcaggcggagcACAActccaagcaccagcagctcgtctcGGGTGTGTCTCTGCCC
GCGTTCTGGCTGTCGAACTACATATGGGACTTCATCATGTACGCTATCCCTGGTTTGTGCGCGCTGATCCTCATCTACGTCTTCAAGATTTCAGCACTGA
CGGGTCAGGACTGCGATAGCTGCTCGTCTGCTACGTTCCCGTCGGTGATTCTGCTGTTCATCTTGTTCGGACTCGCCATCTGCCCGTTCACGTACTGCCT
GTCGTTCCTGTTCAAGGAGCACGCGTCGGCGCAGACGTACACGATCGTGCTCAACTTCATGATCGGCACAGTGTTGATGATCACGTCCTTTATCCTGGAC
ATGTTCGGCTCAACTTCCGACGTCAACTCGGTTCTGAAATTCTTGTGGCGATTCTCCCCGCTGTTCAACCTCGGAAGCGCGCTTTTGAGCATGGTGACGG
CTGATGTCAACAGCATCCAGTACAGCGAAAATGGCAAGACGAGTCCGTTCAGTGGAGACGTCATGGGCTGGGAGCTGCTGTACCTTGCGCTCACTGCTGT
CGGCTACATGAGTCTGGCGGTATATCTCGACTACGCCAACACTTTCGTGAAACCCAAGGAGGacgcccacgagcacgaaAACTTTGATGAAAAccacgag
atcgacgaggacgtccAGAAAGAAGCTGACCGTGTTGCTAGAGGTGAGGCGAACGATGAAGCCGTGAAGCTCGTCGGACTTCGCAAAGTCTACCCTGGAG
GCAAAGTGGCTGTTCGCAATCTCTCGTTCGGCTTGAAGCGTGGTGAAtgcttcggcttcctcgGAATCAACGGTGCCGGCAAGACCACCACTATGAAGAT
GTTGACAGGTGATGTCCAGCCGACGCACGGCACAGCCACACTCGGAGGCTTCGACATCCTGTCGCAGCAGATCGAGGTTCGCCGCCAGATCGGCTACTGC
CCGCAGTTCGACGCTTTGTCCGATCTGCTCACTGTGCGcgagcacctggagctgTTCGGCGCTATCAAGGGCATCCCCGAGTCGTCGCTGGACCGCGTCG
TCATGGAGAAGATCCAGCAGCTAAACCTCGGCGACTTCGAGAACAAGCTGGCCGGCAGTCTCAGTGGTGgcaacaagcgcaagctgtcggtggccatcgc
catgaTCGGCAACCCGGCTATCATCTTCCTCGACGAACCGTCCACCGGTATGGACCCTGTATCTCGACGCTTCATGTGGGACGTCATCGCCGACATTTCC
ACCCGTGGCAAAGAGTCGACAATTGTACTGACGACGCACAGTATGGAGGAGTGTGAGGCGCTGTGCTCGCGTGTTGGCATCATGGTCGGAGGTCGTCTCC
GCTGTTTGGGCAGTGTGCAGCACCTCAAGTCTCGCTTCGGCGACGGTCTCGTGTTCGACGTCAAGCTGGACATGCCGGGTGCTGACGAGCTTGAGTACCT
GGTGCAGCACATTttcggcgacggcagcgagttCGTCACCCctgtcgagctggaagacaagTGCCGTACGTTCGGCAACGCTGATCTTGCTGAGCGTATC
ACGGTGTCACACCCTACGGGTTACAGCCTCGCAGCCGCCATGGAGCGCGATGGCTTTATCCGCGCCGAGGCCTTCTGCTCATGGTGCGTGGAGGAAACGC
GCTTCGATGAGCTGAACAACTACCTTGTGGGGTCCTTCGGTGCGGGCcaggtggtggtgatggagcGCCAGAACGACTTCGCTCGCTTCAAGGTGCGCAG
TCGCAAcaacgaggtgaagctgtcCAAGATGTTCGCGCTGGTGGAAGACGTGAAGACAAGTATGCATATCCGCGAGTACAGCGTTTcgcagacgacgctg
gagcagatcttCAACTCGTTCGCGAGTcaacaggaggaggagcagggGGCAGTTCgcggcgt