Description :
From Genome Similarity Track
Location :
Scaffold_276:11721- 15775
Sequence
4054 bases(100 bases per row)
CAACACAGGCACATACACCTCCGTTCCGCCTGACTTGCAACCACCTTGCAAGCCCTTCACCTCGTTGCCCATGCGACGACCAACTCACCGCACGATCTCG
CCGCACTACTGCTCCTCGTGCGACTGCATGACTTCGAACCGATGTCGATTCGATCGCTGACGCAAGTAGTCATGTAGCAGGGCTCCACCGTTCAAATCCG
CTTCGTCGATCCACGATGGTTCGTCGTATCCCTTCCAGTGTACCAATAACTCCCGCAGCACCCGTCCATACCGTGTACGCCGGCCAGATCGCATGTCGGC
AATACGCTCCACTTCATACTCGTCGTCTTCAAGATTCGCCTCCCAACTATCTTCCGGGAGCAGTGCCTCGTCAAAGTCGAGTCGATCTTGGTTTTGGATC
GTCAGGGTGAGGTGTGGTCGGTCTGGGAAGGTGCGAACGGGCTTCAGCTTGGACACGTGCACAATTGGGAACAGTCGATACTCGGTCCCTGCGATCTCGA
GGCGAGCAGCGTGCGTGTCGACGACCTCAACTACACGGAAGGGGCCATGCCACATGTGCGCAAGTTTACGCGCGTAGCCTTCCTTGACTCGGTCGAGATA
CAGCCACACCTGCATTCCAGCCTCGATCTCGTGTGGGCGCGCCGATTCGTTGTGCTGGTCAGCTCGATCTCGGATTGCCTCACGTAGGCGCTCATTGACT
TGCTGCCGAGCCTGCTGATATTGCTTCTGGACATGATAGCGCCACCTGCGAGGCTGTCGATCCCGCCGGCGCGTCGATCCCAGCGGTACCATTGCCTCCA
GAGTAGATCGAGGGTCCCACCCATGTATCAGGTAGAAGGGTGTGTCTCCACGAATCCGATCTTGGGCCGTGTTGAGCGCAAAAGTAAGGCGCTCCGCGTA
CTCGTCCCAATCTCGCTGGTTGATGTCTTCGACATACATCTTCAGGGCGCGAGTGAGCGTCTGCACCTTCCTCTCAGCAGTACCGTTGGCCTGAGGCCGG
TACGCCATAGTTGCACGTTGCCTCTGACCGACAATCTTGTTGAATGATCTGAAGAAATCCGACATAAATCCTGGCTCGCGGTCATGTCGTATCGCTTCGC
TAGCGCCAAACCGGCGAAACACGCACTCCTCGTAGTTCTCAGCGATCGTTTGGGCTGTTCTAGACGAGCTGGCCTTTGCAATCACTAATCCCGTGAAAAG
ATCGATCCAGATCAACAACTCGGTGTTCCCTTTGTACGACTTGGGTAATGACGGGATGTGGTCCATGGCAATGATCTGGAACGGGTAGGTAGCCTGAAGA
TTACCGGGAGATCCCCCTTGTGTAGTCGGCCTCCCTTTCCCGGTCTCGCAGTCCACGGTCTCGCAGTCCACGCACAGCCCCACGTATCGTTGTACACTTT
GGTAGAGGCCTCTCCAGTGAAAATGGGCACGAATCCGCTGGTAGGTTCTTCCAATGCCTTGGTGGCCACCCTCGAGACTGGCATGATAATGGTGTAGGAA
GTCCTGCTGCAAGGCCTCCGGGATCACCAGCCGCATCACAAGATCACGACCTTCATCAGAGCGCTTCGATGGCGGGCAGTAGAACAGCAATCCAGCTTCG
TCGACCTCGTAGTCATCGGCAATCTTGGCACACGCTTTAGCCTCTGCCGAGGTAAGGTCCTGCACGTCCCCAAGTAGATACTTCTTGAGATCGGCAATCC
ACTTCTCTTCATCCTGGGCCTGGCAGATGCGCTCCGTCTGCATTCGTTGTACCATCAACTCATCCAACACTTGTGGGGCTGCTCGTCTCCTTGATCTCGT
AACCGCCGCGATCTTGATCGCCGCCGCGTCAGATCGAGGAACCAATAATTCGTCGAGCCGGTTGAGCGTCCCCAGATCTTCGCGTTCTCCGTCTGTTGTA
ACGACTGATCCACCTTCCCGTTGTAGTGCTGCGCTTGCAAGTCGATCGGCACTCTACGCTTCATGTGAAGAAATTCGTGGTTGGGCCAAGATCGCAATCG
TTCCATGGCCTTCTGACGTAGTAGTACCAAACTCGGAGCCTTGCACTCGATCTCTCCACGCATCTGACGGATCACCAAGTTGGAGTCGCGATAATTAGGC
GCCGCCCCCTGTCCAGGTTGGCTAGAAGATCGAAACAGAGGAGCAATCCATGGTACTCCGCCTCATTCACCGTTAGATCGATCTTGTACTCAGATGCGGC
GGAGATTACCTTCCAGTCGCGCAAGCCCCACACAATCGCGCTGTAAGCGCCCCCACTTCGCTTTACACGAGCCGATCCATCAAAGCTAACCACCAACAGT
TCTTCATCAATCTCCACTGTAGGAGGCGGCATCGTAACAGCTTGTCGCGGTCGTTTCCGAGGAGAGATCGACGTTAGGATTGAATCGACATCTTCTCGGG
GCGTGATACTTGCGGCTATTACTCCCAAGATCTCATCTTCTCCTTTCGTGCATTTCACGATTTCCAATGTCCACGACGACAGTAGCGCCGCCCACCGGCC
AAGGCGTCCCTGCAAACCGGAAGAATGCACCAGCCACGCCAATGTTGAGTATCGGGTCAGGACCTTGATCGATCTGGTAACCGGTTGCGTGTAGCAGACA
TCCAACATCCGGAGCAGTGCCAACACCTCCTTATCCACCATTCCATAGTTGATCTCGTTCGGCTTGAGCGTGCGGCTGATAAAGGTGACTGGCCTGTACA
CCCCATCGTGCTCCTGCATCAACGCCGCAGAGATCGCCCACTTGCTGGCGTACACTACGACCACTGGTTCCCGATCTGGGTCAAAGTGCTGCAGGATCGG
CGCCTTCACGATCTTGTCCTTCAACACCGTAAATGCCGTGATGGCTCGACCCCACTTGTCACTGTTAGCTTGGCGTTCACCAGCTTCGACTACATCTGCG
CCGACCTCGATCTTGGCTTTCCGAGTGATCTCGTAGAAGTCGGCCTCACGAAGTTCGTACAGCACTGAAGCGTAGATCGCGACGTCCTCGATGAACCTGC
TGTAGTAGTTGATACTGCCTACGAATGAATGCATCGATCTCAGGGTGGTCGGAAACGGCAGATTGGCCAATGCTGATAGATCCTTCGGGTGAGCTTCCAG
TCCTTCCGCAGATACTCGATGTCCCAAGTAGTCGACCTTCTTCAATCCCCAAAAGCTCTTGGTCACGCTGATCGACAAGTTCCATTCCTCGCAGACATCT
AGCAGCTTCTCCACCTTCTCACACAGCGTATCCCACGAACCGGCCGTGACCAAGATGTCATCGATATAAGATCGACGGCCCAGGACAGATGTCTTCTGCT
CTACGTTCGGTTCTCCGTCCTTGAACAGATCGATCTGTCCCTGTCGATCTTGGTTGTCCGTGATCTTGAGGAAGCCGTAGAGTGCGTTGTCGATCAGCCG
CTGATAGATCTGTGGCGCGTTCTTCAGTCCAAATGGCATTCGGTTCCACTCGTAGAGTCCCCATGGAGTGATGAACGCGGAGATCGCACGAGCTCGATCT
GTCATCGTTACCACCCAGAAGCCGCTAGCCATGTCCAGCGAGCAATACCAGAGCACCTTGTCGAGATCCTCGAGAAGATCGTTGATCAGCGGCATCGGGT
AGACCATTAAACGTGTCAGACTGTTGACCAGACGGTAGTCAATACAGAGTCTGACGTCGACCCCGTTCTTCTTGACGATCACCACGATAGGTGATGCCCA
AGGGGACGTTGAGATCTTGATCATCTTGGCCGACAGGAGCCCCTTGATTAGCTGCTCCAGCTTCTCGCGGTACTGCGGCGCCACTTTACGGCAACGGTGA
GCGACTGGCTTCGCGTTTCCAACGTCAATGTCGCAGATCGCACCTTTTGCGGCCGGTGGTAAGGCATTGCCCTTTCCAATAAACAAGTGCTTCCGGCGCC
AGATGATCTTCCGCAGCCGGTCGATTTCCTCCGGCGTGTTTTCGCCAGGATCACCAACTTGGATATCCGTGATCACGACTTCGTCAGTCGCGGTGAACTC
CGGGAGCACTGCCATTTGACCTTCGACATCTTCCGCGTAGAGATCACCGCCTTC