Description :
From Genome Similarity Track
Location :
Scaffold_163:11721- 13807
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_163-abinit-gene-0.55Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_163-fgenesh-gene-0.10Syntaxin 7

Sequence
2086 bases(100 bases per row)
GGTGACGGAGATTGGGGCGAAAGTCCGGCGGATGTCCGGCAACGACGCGTGAAGAAGGTGTTGCAAAGTATGATAGCGAGACCAAAAACTATTTTTCTAG
ACGCCGTGAAAATGATGATGAGAGCGTGTGGTAGCCAGAGAGAAAGTCAAGTTGAGGGGGAGGAGCTACAGAGAGAGAGATGAAATGCGAATATGAAGTT
AACTAAATGAAGACGGCAATGAAAGGGTGAGGAGCCAAGTTAATTTATTGCACAAGAAAGAAAGAGGGAAAATGGCGAAACAGTTCTGGTTGCTTGCTCC
TGCACCACATGATGGAGAATGTTGATGGCCGTGAAGCAGTAACGCATCCACACCATTACGAGAGACCGATGATGAGACCCAACAGGATGATCAAGATGAT
GAGTGTGAAGCCGCCGTAGCACATGAGCTTCCACTTGGAGCACGCGCAGTACTTGGTCTTCTGATCCGCCTGACGCACTTGCTCCAGCGCTTTCTCGACA
TTCTCCTTGGCGTTCTCGGTGTTGTCCTCAATTTCCACTGCATCGTTCAGAGCATTTAGAAGTACAAATTAGCTAGGAGTCGCTACAGCCAGCAGGAGTA
TTAGCGTGATAGAATTGCTTTGGGATAACGTACCGATGACCTCGCCCTGGTCTTCGATGAGTCCGTCGATCTCCTTGAAAGCAGCGTTGACCTCGCGAAG
CTGATGGTTGATGTGGATAATATCCTCCTCTCTTCGCGCCAGATCTAACCATTCGCATAGCCCACACGGTATTGTTAGTACATCCTTGCTACACATACAG
ACACACATTCAAAATCCACAGCACATACCGTCTTCGTCGTACGCGATGATGTTTGCCTGCGCGTAGATCTGGTCCTCGTTGTAGTTGGAGAACTCGACTT
TCGCCTTCGGGTCGTTGTGGTTGAACGAGTGCGACGACCGCCGGATGAAGTCGACCGACTGCTTCTCGGACTCGATGAGCTTCGCGCACGTCTCCTCGAA
CGCGCGCAGCTGAGTCTTGAAATCGGTTGAAAGTTTGGTGACCTGGGTCTTGCGCATGCGCGCGCTCGCGCCGTTGCTCGATTTGTTGAGCTCCTGCAGC
CGGCGGTTGATCTTCGTGACGAGCTTGTTGCCTTTGTCCGTGAGCTCCTTGAGCGTCTCGTGGTTCGCGCGCGAGTCCTGTGGCGTGTTGAAGAGCGACA
TCTTCTGCGCCATCGAGCGCGTCAGCTGGTTGAAACTCGAGATACCCTTGGACGTCTCCTGGATGAGCTTCTGGTACTTCTCGTCCGAGAGCCCGCGCTC
GCGCGGAGACGCCGCTGAGTGGTACCGATCGCCCATGTCTCGTTCTGCTTGTCTGTCTGCGTACGTCTGCGGGTCTCTCTGTATCGGTCAAACGATGCAG
CTTCAGGCAGGCTGATGGTCCGTCACAGACACGCGCGCTGAGCTTGAGGGTCGAAATGCGGAACTGTGGGGATATTAATGCGGTGTGGCGCGGGTGAAAA
TGAAGCGAGCGATCGGTTTAAAACTGGATGTCATGAGTGCGTGGTGATGATAAAGTCAGTTTAGTCGAGCGCGAGTTGCAGTTTTGTAGCAGCAGTCGAC
GATATTAAGCGTTATGTAACAGTAGCGCGTGATTGATGGAAAAGACGAACCTATAAAGTTCGCCCCACCCATTTTTTGTGGCGGGATGGTCCGCTGGAAC
TGAATGGACACGCCTATTAGCTCGGGGTTGCTGTATTAAGCGCACGATGGCGAATGGTGCCAGCTGGCGACCGCGAGTGGATGAGCGAACCTAGACAAAG
CATTTGGGACGGGCCATCTGGCTTTCCAAGCCATTTTGTGCAGATTAGAGGTTGGTTGGAGAAACTTCGAGCCTGGGGGTTCTCAAAATTCCTGGGACCC
CTTTTTGCTGTGCTATGTTGTGATGACCAGCTCTGTTGTAAAAGTCTGGATGGAGAGAGAGAGCGAATGAATGCAGTTTTTGGTGTGTTGCTGTGCACCA
ACCAGCCTCACGCATCCAGTCGACACGAAGTGGTTGCAGCGTTGTTTACAGACTCCGTGTTGAGTTGTGTGTATGTATGTGTGTGT