Description :
From Genome Similarity Track
Location :
Scaffold_814:1172- 2823
Sequence
1651 bases(100 bases per row)
CACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCTTTCACGCGCTGCACCTTA
AGGTGCCACTGCGATAGCAGCACTGCGAGCTGAACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACAT
GTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTT
GAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCATCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGA
ACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAA
CGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAATAAACGACTG
CATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAG
TCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCGAATCTTGCTAGCAATCGGTCCAGCGTCGCCAGGCAGCTGT
CGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTC
AGCGACGGGGCTGTTGACGAGTTGTAGTCCAGGGTCGGTTTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTAGGCGCTTGGC
CCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAA
TCATACGCTGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCTAGTGCGCAGACGAACGCCGACACTTTACGCGC
TCGTAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAACAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCATCGACTAGCGGC
ATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCCGTTCGTTTTCATCACAATCACGATCGGC
GATGCCCATGGACTGTCTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGCAGCGGCACGCGCCGGG
CACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTC
GTGGTTCTTTAGCGTCGCGACTAGACGTTCTCGGCGTTCAGTCGACAGCTC