Description :
From Genome Similarity Track
Location :
Scaffold_56:117185- 118939
Transcript NameFunction/comments
Phyin_T30-4PITG_17766Amino Acid/Auxin Permease (AAAP) Family

Sequence
1754 bases(100 bases per row)
GGAGCATAGGAGCTATGTCAACAATTAGTAGTAGTTTTCATGAGCGGCCGTATAGTTGTAATACACAGTATTCTCAAACTCCGGCGCGCAGAACGGAAAC
GCCGTGTCATCGTCGCTTGGAGCAAACAGGTTCTTGCCCGATGTGTACGTCACGTAGCAGCCCAGGCAGAAGCACACCACCACCACGGTGAGCGCCGGGG
CCTTCTCCCACATAGGAAGCGAGCCCCATTTTTTCTTCAATAGGAACACAATTGGCAGAAGGATTGAATTCATCGTAATGCACGACGCTCCGACGAAGTC
CGCTAAGTCCGAGAAATGGTCCTGCAGAAGCACTGATGCGATTGCCAAAACGATGATCATCACAATACGAAGGATAACGTATTTGATGGTGTTGGCCCCA
CGGTACTCAGCGGCCTCGGCATCCGGCTCACCAAGGTGCACGTTCTCGTTATCGGCAACAGAAATAAACGAGCGCTTGGAAGCACGGGACTCCTTCTCCG
AGCGCTCTGCACCATCACGAGGAGTAGCAGCGTCGGCGTAAGTAAGTAGATTGTTCTCCACGTCAGCGACCGTAGACTTGTGCATTCCGAGCAAGATGCG
CTCGGCGATGTAGAATGCCGGGTTCAGGATAACGGAGAAGGCAATCGTAATGTGCAGTTGCATAAAGAGGTAGGCAAGAACGACCATACCCCAGTCCGAT
GCGAAGCCCAGCGTTGTCAAGCCAGATTCCGAATCGGGGTAAATCGACCACAGCAGGTTACCAGAGATCTGGCAGCCAACAGATGAGTATGCTGTACTGG
CGAGAACCAAGAAACAACAAGAAATGAATGCAATTGTCACGCCGACAACTCGGGGCATGCGTGTGGGGTCACTGTGCTGGCGCTGGAGAGCCGGAATCAC
AATACCAGCACCATAAGCGAGAGCTAAGTTGCCGAACGCTCCAGCGACTTGCTTGAAGTTGATATCAGGTGAAGGCACGCTAGGGTGACCGCGCATGCCG
TACATTACGACAGCGACGCCGATAACATCAGCGATGAGCGTGCCAATACACCCGGCGAAAGCAGCACCAGCTCCTTCCTTCAGAGTAGGCACCAGGCATA
CAGGTAGGCATGCGAGAGCCATGAGGATGATCCACGTCGTTGCGCTGAAGGCCGCTGGGAAAAGACCGTCGAGTAGACTACCACCAAGCACCAGGAACAC
ACACGGGACCAAGAGACAGTTGCCCATTTGAGAGACAACCGACACGTAGCGGCCAGTTTTGCCCATACACCATTCACCGAGGTCACCGTAGGTCTTGACT
GAACGCGGGGCGATGAGCATGACGCGGCAGATAGCAACTGAGGAATATGTGTTGGCGAAGGCCATGAAAGCCATGGCGATGACCGCGATCACTGGCCCGG
CACGGGAAAAGTTACCGGGCATACCAAGCGTTCCAATGCCGTAGACGCAGCAGAAGAGGTTGAATGCCGCTTTAGCGTCTTCAACCGTGAAGACAGCCGA
ACGAACCATTGTGGAGTTGGTTGAGTGGGTCACTTGGGGTGGGGGTGGAAAATAAAGAACTGAGCTTCAATGAGTTTGGCCCACCTCAACGAGCAGATCA
AGTTGATCATCAAGTAGGCTCTCCCAAACGATTTTGCAAACACATGGGAATCAGCCGACGTCATATGGTGATGGCCAATGAGCGCGCCAACATCACCAGT
ACCGCACCTTCTGGTGCTCTGCTGCACCGGCACTAACACGGATTCTGTATCAAA