Description :
From Genome Similarity Track
Location :
Scaffold_7:1171181- 1178840
Transcript NameFunction/comments
Physo_337999UDP-glycosyltransferase UGT33B8

Sequence
7659 bases(100 bases per row)
AGAACCTTTCCATGGATACAGAGGTGCCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTG
GGAAGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGTCCTGGGA
TTCATCATGAGGGAACAGCGAGATGCTGCTTCGTCTACCACGGTGCCGTCGGGGACGACACCGCGCGCGCAATCGCTGAAGGTCAGCGTGAGCAATTACG
TTGGAAGAGAGGGCGAGCCTCTCCTCAGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCGCGTTCGC
CATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTC
AGGCAAGTGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAG
CACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTGGTCACGTTCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTA
TCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAAGAGGAGTTTAGCCTGCGGCAGGCTACGCTGCATGCACATGCGCCG
AGGCCACAGCCTCGCCCGATAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTACTGGACCCCAGCAGTCGCAAGGAAACAATG
TGCGATGCTACCGATGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCCCGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAG
TAGGCGCGGGGTGCCCTACTGGTAATGCCGTTCCGCATGTCGACCATGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAA
GATCCAAGATGACAAGCCTGACCTTGTCATCCTGACCTTGAACTCGATGAGAGCAAGCGGCTCTCTTCGTGCTTTGGTAGACTCTGGCGCGTCGAAGAAC
TTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGCTGGAGGTACGACTGGCAACGGGTGCCGTCGTGAAGA
CCGAGAAGCGCATGGTACGCGTGTGCTTCACGTATGAAGACCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATCGTATT
GGTCATGCCGTGCAAGCCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGCGCGTTGGCCCT
GTTGCCGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCAAGCGCGCGCGCA
AGAGCAGCAAGCGTCGGCGTCGTCGCCGATGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCG
ACCTCAAGGGGCACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATGAGTTTTGGCCAATAACAAGAGCCAAT
GTGACGAAACGCCGTCGACTCCGGGGGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGGGGTCTCCGCCAG
TGGTTGGCGTCGAGGTACTGAAGTCGCGACGGTTCCGGGAACCGGCGCTGCGAAAAGAAGTTTCGCGTCGACTCCGGGAGTCGGCGCACCCTTTGTGACG
GAGGGCTCCGCCAATAACAGGCGTCGAGGTGCAGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTTCGGCACCGG
AAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGATGTCGCTCGCCCGCGGGATGAACCCGCCGGCGG
TACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCG
CTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGC
GTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTCCGCTTCCAGTCATGAGCTGGAAGCGCTT
CGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATG
GAAACCACCACTGAGAGTGAGGACACTCACAGTGCGAAGACTAAGAAGGAGCGCTTTGAGGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACG
AGATTCTACGGGAGTACGCGGACGTGCTTCCGGAAGCGATCCCTGCGGAGCTTCCGCAGGATAAGGGGATCCAGCACGAAGTACTGTGTCACGCGGCAGT
GGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTAGATGAGTGCGGGAATCGAAGTCCCCGCACAGTGCTCC
GACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCGA
AAAGATGTCATCCTCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCC
CTCTCACGGATGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTGGTGATGCCGCAGGGGCTGAAGAACGCCCCTGCGACCTTCAGCAGGTGCGTGAC
GCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACACAATGAGCGATGTTGAGATGCAC
AAGTGCATCTCCGGAAGTTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGG
GTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTAATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTC
CTTGGCTTGGACACGTACTTGTGCAAGTACGTGAAGGACTACGCCGGTATGATACGCCCGCTGTCACAGCTCCTGAAAAAGGACGCCGAGTGGATTTGGA
CTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACGGAGGCGCCGACCTTGGCGGTGGCCGACCAGGATCGCCCATTCCACGTTGTGTT
TGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCT
GAGCGCAACTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCAAAGTTCCGAGTGTATCTACTCGGAAGCAAACTGTTCGTGGTCT
ACACAGACCACGCGTCGCTGCGGACGGCTGGGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGT
TGAATACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGCCTGATGCCGACGTCAATGCCATTGACGCCATG
CGATCGAGCACCCCAACGTCGTCTCTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTT
CTGACAAAACTCGTCAGAAGTTGCGGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACTCTATAGTGCAGTTGACGACAA
CGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAG
ACATACCTTCTTCTCACGCGAGACTTCTACTGGGCCCACCACCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGA
AGGCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTACCAACTCCACGAGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGA
CAGCCAGGGGAACACAGGCGTTGTGGTCTTTATTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGGGACTGCGAAGCAGACGGCG
CGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGTCGATCGACATTGTGTCGGATCGGGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGT
TCACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAA
GAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCT
ACGTGAATGCCAACAGACACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGTCGCA
GAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGCAACAAGAAGAAGAGGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCA
GAGGCCGGGCCTACTGCTAGAAACGAGCTGAACTCGTTCAGTTCGGACGAAATCAACTTCGTACAACGCAGACAAGCCGTCATTCGGTTTGTCCAAGACG
CTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTGGTTTTGTCAGCTAC
TCAAAACCTGCCTAAACACGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCC
TACATGCTAGATATTCCATCTAGCATGCGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCATCTAGCTCGGCTGGCC
CGAAGCGGAAGCCCCAGCGGGAGTGAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCGAC
GCGGTCTGCGAACCCTGAGCGACTCGAGCCCTCCGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCCGGCTCTGATGCTGTTCGACAGCAGCGACCC
GCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACAC
GCTGGATTGTTAAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAGCCGTTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGA
TACATGGGAGCCGCGGAACGTCCTACTGCTGGACGTTCCGGAAATGGTGAGAGCGTACAAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGC
TGTGGTCACCTACAGCGCCCGAAGTCCCACGATCGTCGCGCTCCTCACGTGCCAAGAACTTGGCACGGAGATTCTTGAGACTCGCAGGTACACGAATCGT
CGTGTACCCGTTTAAGTCGCGGTCGCTCAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGATGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCC
ACAGAAGATCTGTGGAGCTGCTCCAGCCTCCCGCGCGTCGAGAATGTCTCGCAGCGCTCACGGGCATGCTTAACCCGCTCGCGGTAAGCAGCCGGCTTCT
TGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTACCGGAG
CTCGTGGAAGAGCCCGGTGTAATAGTCACGCCTTTGGTTCGTTAACGGATCAAAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATACCGCTGCATACG
TACAGCGGGATTTCATTTGGAGGCACAGTGTTGCCCACTCGGTCTGCGATCTCTGACGCAGACGGCATCCGCGGAGAGCTTGAAGGCGCCACCTCACGCG
GAGAGCTTAAAGCTCCAGCAGCAGAGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCG
ACCCGGCATGCGGGTCGAGACTATCACTGTCGATAGACTCCCTGCGCTTGCTAGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGTCATCCTCGAAGTC
AACGGCGTCGTTGACTACAGAAGAACCTTCGAGGACAATCTCTGGTTGAGTTGTCCCCGCCGCAGCCTTGGTAGCAAGAGCGTCACGCTTTGCTTTGAGA
CGCTCGCGGTACTCGGGGATAGAGAGAGTCTCTATCCCGGCGGAGGACTTCCCCTCTGCTGCAGCGTCGGTCTTCTTCTCAGGCGAGCTCATTGCGGAAT
GAGCTCGAGTTTTATTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGAGTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGATGG
TGTAACAGGGTTACACGCACAAGTGGCAACAGTCACCTGTAACTCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTATAGA
CACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTTTTAGCCAATGAGCG
ACATGCATAGCATTGGAATTCTGCCTACCAGCCGTTGGCAAATTCCTATCTAAGAATATTACATTTAGGGGAAGTCAGAAACATAAAACAAAAAATAGCA
GTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTGTAATTAACTCTAATTTAAACTAAGCTACG
CTTCCTCACATATACGCGCACACGTGTAAACTAAAGTAGTGAGCCAAAGGCCCACTACA