Description :
From Genome Similarity Track
Location :
Scaffold_57:117111- 119757
Sequence
2646 bases(100 bases per row)
TACGACTTAAGGAGCCCGACGTAAAACACGGGGGGTGTACGCAATTTGCGCGGTAAGTTGAGCGTATACGCAAGATTCTTCTTGGTCACGACCGCAAATG
GTCCTATGAAGCGAGGAAGCAGCTTCGTCTTAAACACAGCAGACACTACATTTGTAGGTTGGTTCTTAGCGGTTGGTAAGACTTGGTCACCGACCTCAAA
ACTTTCAATACAGATTCTGCCTTTAGCATCCGCTTGTTTCTTCTGTTTGTCTTGGCTATCAGCCATTGCGTCACGCACATGTCGTAGGACATTTAATCAC
GTTGTGAGGAACGCGCTAACCTGTTTTTGAGCAGTAGCAGGGATGACATAAGCAAGACGATCGGCCACCTCTCCCCCACCAAGCCTTGAACCGCGTAGTG
GTAGCGTTAACGGAAGGAGGGGGGGTGTGAGGCCGTTCACGTAAAACGGAGTACAGCCTGTGGAGGCATGGACGACATTGTTCATGGCGAGCTCAACAAT
GGGGAGCATTGAGCTCAAACGCCGAGGCGTCTCAGCGCACACGCTGCGTAGGACATCTCCGAGGACGCGATTAACGCGCTCAGTCTGACCATCGGTCTGC
GGATGATCCGTTGTAGACATGTCGAGTCTGGTGCCTAGCACCTTGAAGGTGGACCTATAAAACATACCCGTGAAAAGGGGATCTCTGTCAGAGACAATTA
CCATGGCAGACCTTGTTGTCCAAACACTCGATCAATGAACAGCAAAGCTGTACCTTCAGCATCAATCGAATCCGGCGCAGCCACTAAGTAATCCATCTTG
CTCAAACGGTCGACAAAGACCACAATATCTGTAGTGCCGTCCAAATACTTTGGTAGGCCAAGCATATAGTCGATGCTGATGGACTCCCAACACTCAGAGG
GTACAGGAAAACTAGCCAGTGGCGCAGTCGCATGAGCTGAGGGTTTGACCCGTTGGCACGTTTCACATGTGTGCACATAAGCGCTTCCTCATTTATGGAG
TTTGGGCCAATAACTCTGGCTAACTAAGCCGTAGGTCTTCTCACGACTGATATGACCGCTAATAGCTGTGTCGTGAACCTCATAGAGGATTAGACACTTC
AGTTCTTCATCATGAGGAGCAATGATACGCGGGGTATCCGCAGTATCCGTGCGATATCACAACAAGCCGTTATCGATAGAATATCGATGTATCCTCGCAC
GCAAACGTGCCGACAATTTAATGTCCGAGTCTTTAAACTCATCGCTTCCAAGAGCACGTATCAAAGCTACACATTATTCATCCTTGGCATAAGATCCACG
GATTATGTCAGTAATTGACGACGACAAAGTCATAACATGAGCAAGCTCATAGTCAGGCCGTCGTGACAGCGTATCAGCCAACTTATTTTGCATTCCCGGC
TTATACTTCACCTCGAAGTTATATTCTGCAAAGAATGGAAGCCAACGGGCCATCCTCTGCGAAGCGATTGAGTCGCTGTGCTCAAATATGCATGATCGGT
ATAGACTACAAAAGGCTTATAGCCAAGCAGATGAAAACTGAATTTAACGAGAGCATACGTCATAGCAAGTAGCTCCTTGTCGTGAACTGAATAGTCCTTT
GCAGCAGCTTTAAGCTGACGGGATTCAAAAAAGATAAAATTCTCATGTCCCTCAACATCTTTTTTATAACAGAGCACAGCCAATGACAAAATCCAAAGCG
TCAAGAACGATATTAAAAGGCCGATCAGAATCTGGCAAAGCCAAAATAGGGGCATGTAAGAGACTCTCCATTACGGATTTAAAAGTCTCATATTTGATGC
TAGTCCAGCCCACTTCACATGGCCGAGCCATATCAGCGTAATTATCGCTATACTTGTGCAAGTAATTGGCAAAGCCAAGCCACTTGCGCAGGTCCTTTTG
GTTCTTAGAAGCTGGCGAACCCACTATGGCCTTTACCTTTGCAGTATCCGCACAAAGACCTCTCTTCCCAATGAAGAATCCCAAATGGGATCTCGTCCGC
ACCAAAGATAGATTTCGATGCATTAGCATAGAGCTTATTAGTGTACATTCACTCAAGCACAGCTCATAAGTGGTCTATGTGGTTATCCACGTCTGAAAGA
CCCTTTTCTGTGCGGCTATGAACAAATGTGTCATCAAAATACGTTTGTGCATAAGCACGGTGAGGGCGGAACAGTCGCGCCACCAAACGGTTAAATTTAG
CCGGGGCATTAGAAAGCCCCTGGGGCACAACCAGCCATTCTCAATGCATATTGCTTGGAGTACTAAACGCTGTAAGCGAGATATCACTTTCTCGCATGAG
CAGTTGATAACATCGACCAGGTCGAGTGCACTGTACATTGTACATCCTGCCATGCTGTTCCGAAGAACATCCTTTTTAGAAATTGGTGTCTGTGCCGGTA
TAGTGGCCGCATTAAACTTATTATAAGCATGCACAATATGCCACTTACCATTGGAATTTTTGACACAAAATTTCGGTGTGAAATGAGGAGACTTGCCCTC
ACACACCATTCCCGCCGCGTACTTAGCACTGAAAAACTTGTGAATGACGTCACATTGTTCCTTTGGTCAAGACCACTGTCGTGCAATGCAGTATTTGGTT
CCAGGAACCAAGACAATTTCATGACGTAAACCCCTATCGGGAGGTA