Description :
From Genome Similarity Track
Location :
Scaffold_1524:1171- 8917
Transcript NameFunction/comments
Phypl_g13616hypothetical protein

Sequence
7746 bases(100 bases per row)
TTCCTCCGGCGGGTGAATACGATCCGGATGGCTTGAGTATCGGTAGACCTCGACGTGCTGTGGCGGCGACCGCAGAAGCAACGACCGGGGGCGCCACTTC
GGCCGCACGAATCCGAGTGTCAGCGATCTCGGAACTTAAGGAATTCTCGGGGAtggacaacgacgaagatcgcgccagcagctggctCGGCAAAGTCAAG
TCGGCGTTCATCCGTGATCAGGTTCCAGATAGCGAGAAGTGCTTGGTCTTCGGCGATCTGCTCACGGGACCAGCCCGCAACTGGTACCGGCAGTTGAGTC
GGACGACGCGAAGCAGGTGGAAGAGTCTGTTCGATGACTTCCTGATCCAGTATTGCGGACGTGGAGTGTCTGTCGCGAGACAGTACTACCACGCGAGGAA
GCGATCCGAGGAATTACCGCTCGAGTATCTACACCGACTGAACGTTGCTGGATTGCGAGCAAAGCTCCCGATCAAGGATGGATCGCCGGACGCCCGGCGA
GAACACGTCGAACACTTCATCGAGACGTTTGACGATCGTGACCTGGCGGATCAGCTGGCGCTACTGATGATCGCCGAAGCGGGCCATCTCGAAAATACGC
TGCGTGCGCGCCAGCGCGCCAAGACCCGCCAAGGAAAGGCAGCAGTCGGATCGAGTAAGTTCCGCCAGAACgctgcatcgccagcacATCTGGCTCCCTC
GAAACCTGCTCGCGCGGTCCGAGCGATACAATCGAAGGAAAACCTCAGCAAGTCCGAGTCGGAAGCCAGCGGATCACAACCAGAAGGCGATCTGCGCCCG
ATCTACCTCCCCCCATTCCGATCGTCAGGAACAAGGCAACTGGCAGCCACCACGCCCAGGCGTGCGGGACCGCAGGATCGACTGGACCCGAGCTTCCAGG
CGAAACAATGTTCCCACTGTGGATCCAGGAAGCATGACGACTTGAATTGCTGGAAGAAACTGACTTGTGAGAAGTGCGGCAGGAAGAGGCATCCGTTGGA
CCCTTGCCTCTTCATGTGTCGGGCCTGCGGCGAACTGCACGATGCCAGCAAGTGCCCGATGGAGGAGTTCTACAACTTGATCCGCCAGTGGTACAACCCC
AGCAAGCATGCCGGGATGTTGCCAGTCAACGCGGAGAAGATGTTAAACTAGGACGCTCGTCGGGTATGAATCCGATACGAGCCGAGCGTTCTAGATATTG
CATATTTGCATTCACGGACAAGACATCGGTGGATCAAGTTAGCAAGCGACCCGATCGACACGATAATACATGTGAACTGCATGGGAAACGTACCGTGGCG
ATCTCAAGCCTGCGGCTGGACGATGAGTTCTCCAGGTCCGATGTCACGGTAGCCTTGGATCTCCAACTCGGGGAACAACGAGGTTACTGAAAGCAGCGGG
ACCCAGAGCAGTGGTTCGCCCCTGCCAAGAAGGAAGACACGTCGGGAAGTCCAAGTATCCTGCAGGTCAAGACGGCTTGGCCATGTGGGGGCGGGGCGCT
TCCCGATCTGCAGCCCGGAGAATCGCGAAGGTACTGGAAATATCATGCCCCTGGGAAGTGGTTCAAGCAAGCCAAAGCTGGCGCCAAGGTGAACAACGAG
AAGGCCAAGTTGCTCTTCGACACCGGCGCTGAAGTCTCGATCATAGACACTACCTTTGCTCGTAAGGTTGGGTGTGTCATAGACGAATGTCAGAGACAAG
AATGTGTCGGGATCGGAGAGAACACATATATGACGGTTGGACGTACCACGATCAAGGCCACGTTGGCTGGATCGATGGTGTACTACTTCGACACTTGGGT
TGGCGGTCAGTCGGGGCAGGAATCGATACTCGGCATGGACTTCACGGTACCAGCCGGAGTCCGCCTCGATTTAGCAGATGGGACGTTCTGTCTCCCTGAT
GAGGTTCGGATTCAGCTGCTAGGACGGCGTCCGCTGTACGGGTCCAGCAAGATCTTGCTTGACCAAGATCTCGAAGTGCCAGTTGCCGAGTCCGTGGAGG
TCCCGATCCGATGCGGCAGATCGGCTAGCGCGAAGCTCTGGATCACACGGGGTTCAAGATGGGTTCCGACCGCTATCAGGGGCCTGTGTAGAACGAGGTA
TCTCCAGATCACAAACGTGAGCGAAGAGAAGTTAGTGCTCGATCGGCACGCACGACTAGGAATTTGGTTAGCCCCAGACGCCGTACCTCGCATGCCCGGT
TTTATGTCAGTCGGATCGCGCAGGTACGCTGAATGGCAGAACCTCGCGTTCGAGGCTACCACTGAACGACTGGAGGAGCCAGTATCCGAAGAGGAGCCAG
TGGGACCGCTGGTAGATCGGCCTCGATatccgacgccgacgcaAATTCTGAGTCGATCGGATGGGGCTCTCAAACCAGTGGTGGCCGTAGCGACCACCTT
ACCATCGCCCTGCGAAGGAACACGGGAAGGCCCGCCGGAAGCCGAGATGAAGCGCGAAGAGCcggacgaagagcgagttGCCCGGGAGCCTGCACCGATC
CGAAAGGAGGAGTCGACCGAGCCAAGCCAGGATTTGCCGAAGACCGATGTCGATCCTTAACGGGAGTCGATCTCGGATGAAGCTAAGGCAGAACAAGTCT
GCTAccacgaaggaggaggcttGTTTGCAGAAGATCTCGAACAGAACTTGGTCATCTTGCCCGAGGTAGCAGCTTCAACCGAAGAAGTAACGATCGAGGA
CATTCAGGTTGGCGACCCCGCTCTGAATACCCCGGAAGAGATCGACCGGCTGCGACGGATCATctggcgaaggcggcacTTGCTGATCGGAAAAGGGAAC
GCCcagccacctgcagcacgcggtgcaGTTTGCGACATCGACGTTGGTGGTGCCACTCCAGTAGCCCAGCGTGTGCGACCAGTTGCTCCACAATTTCGAG
AGAAGTTGGCTGCGCTGATCAAGGGTTTGCTGTCGGCCAGGATCATCAAACACTCGACCTCACCGTGGGCATCCCCGATCGTGATCATCATCAAGCAGAA
CGGTGTTGATATACGACTCTGCATTGATTACAGAgtcgtcagcagcttgacgcgcttgaTGGTGTATCCGATGCCGTCGATCAACAATCTCCTGGAAGAC
TTGGATAAGATCTTGTGGTACTGCCCCCTTGACATGGCGAGCGGATTCTGGGTGGTCTCCATGACTGAGAGTGCACGGTTGATCTCAGCGTTCATCACTC
CGTTCGGGCTGTTCGAGTGGCTGGGTAAACCATTCGGACTGAAGAACGCGCCTCAAATCTATCAACGGCTTATCGACAATGCTTTGTACGGACACTTGAA
GATCAGCGCGGATCCAGACTTGAAGGAGACGAGTGACGTCTTCGAGGAGGGCAAACCTGACACCGATCAGAAGCCGTCCGTCCTGGGGCGTCGATCgtac
atcgacgacatcttAGTGACGGCCGAGTCTTAGGACACCCTCTGAGCGAAGGTCGATCATCTGTTGGAGGCTTGCGAACAGTGGAACCTCTCGATCAGTG
TCGTCAAGAGTGTCTGGGGACGCTGGAAGGTCGATTACCTGGGTCATCAGGTGTCAGCGGGTGGACTAGAAGCCCATCCGAAGGATCTCGATTCCCTGGT
CAATCTCCCGTTCCCACGTACGCTACGATCGATGCAGTCTATCTTGGGCAGCTTGAACTACTATAGCCGCTTCATTGAAGATTTCCCGATCTACGCTGTG
ATCTTGTACGAGCTGCGAGAGGTGGATTTCTATGAATTCCGTAGACGAGCAGACGGCGCAGCTGGGAATAGTGACTGGGGGCGCCCGATCATCTCCTGAA
GAGGAAAGAGGGCGATCGCTGGGTGAGAGCCACGATCACGTTCACTCTGCTGAAGGCGGAGATCGGTTCTACGCCGATTCTCCGTCACTTCGACCCGGAT
CGGACTCCAGTCGTAGTGGTATACGCCAGCAGATGGGCGATcgccgcggcgctgatgCAGGACCGTGACGGCGTGTACTGGCAGGTGCCTTTTTCACTAG
CCGTACCTTGAAGGCGAACGAGATCAACTACGGGAAGGTCGACAAAGAAGTGTTGGCTCTCCTCCGTGTCTTGAACGGCTGCTACACGTTGCTCGTGACG
CGATCGACCAAGGTGTTGACTCGTCACTCGACGCTGGCATGGCTGGCGAACTCTTCTGGACTGGACGGCAGACTCGGTCGCTGGGCTGCGTTCCTTTCCG
AATGGACGCTTGAGATTCGAAAGCGTGCGAAAGGAGCAGACAAAATCCTTGGCACGATCGCGGCAAGCATCAAGCCTCGATTTGAAGTCGATGAGACGTT
GGTCGCAATCGCGCCGAAGAAACAGCCACGTCAGGTGGTCAccatgctgccgccgacaGTCGAGCTGAATGAGAGTCTGCTAGTCGTCAGCTCCGATGGA
TCTGCGAGCGTCAAGCGAAAGGCCGGAGCCTACAACGCGATCATATGGAAGCTTCCCGACTGGACGATCCTCgctgcgtcgtcggagtATGCGGCTAACC
TGATGGTTAATGAAGCCGAATATCAAGAATTGCTGCTGTGTTTCGATCTCCTGTCCGATCTGAACAGGGGGCGACTGGTCATCTGCGGAGACTCCAACTT
GGTGATCAGATGCGCGGCGAGATCGACTCCAAAGCGCCCGGGTTGCTGTTGTTACGAcagaaggcgctggaaaATTTGATATCATGGCCGAGACACGAGC
TCTTGCACATGAGGCGCGATTGGAATCAAAGCGCCGATCGGTTAGCGAGTGGCGCGCTTCAAagccaagaaggcgcagtCATTACCTCGGAGGAGGATCG
CCAAGACTTGATCACTCTCAATCGACTTGACGAGTTGCTGAAGCCGAAAGCGATCGACACGGTCGTCCGCGTAAGCGCCGTCACGAGATCGGCGATACGA
CGACCCCAACAGCCGGAAATCCTACAGGAAGCGATCGTACAACGCATGATAGGTGAGCGGATACGACAAGCGCAGGATGAAGAGAAGTGGATCGCTGATC
TGAAGGATTACCTgaagggcgacgtgcaggagctgaccGCCGAGGAAGCCAGGTTTTGTCCCAAGATAGCAGCTGActacgagctggacgagagtggcct
gctcttcttctgcccCGCCAGGAAGTCGAAGGACGAGGATTGCAATGCAGTCACTGGACTCGTAGTACCGGAGATCCTGCAACAGGACTTCCTGCATCAC
TACCGTGTCAATCTGGAGGGAGGCCATCAAGGAATCGGGTGGATTTAAACCTTTGCATCCGATTGCACTTTAACTGGCGAGGCTTGTATCGAAGTGTCCA
GCGCTATGTGGGAGAGTGTACAGATTGTAAGACTGGGAAGGGGCACCCCTTTGTTCAAGGAGAATCCCCTGGGAACGTGCAGGCCACTTACCCATTCCAG
ATCGTGACGACGGACCACATCCCTTCGCTGCAGAAGCCGTTCGAAGGGAACACCGAGCTGTTGATTTGGGTCGACTTGTTCTCGGGCTACGCGATCGCGA
AGGCGATCGCGTCGCGCACAGCGCAGATGATCGCGGAGAATTACGAGGAGTGCGTGTTTCGACGCTTCGGAGCCAGTGAGGCCATGCGCCAGGATCGAGA
ACCCGGGTTTGTGTCTGATTTCTTCCGTGCGTTCAGCCGGATAGTTGGACAGAAAGAGAAGGCCACGATGGCCTATCGTCCACAAGCCAACGACAGAAAA
GatggtgcagacgctgacTCGCGCGCTCAAGATGTACGTCGCAGACGTGAATCAGCAAGACTGGGACGAGTACGTGGAACGCCTAACGTTTGCGATTAAC
ACGGCCCAAGATCGCGTCCGAGGCGACACCCCGTTTTATTTGGTCCACGGTTGGGACGCTCGATCAACGCTGGAGGCATCTCTACCGCTGGGCTATACGC
GGCGCCGAGACAGTGAACCGCGCCAATGGCGGTATCGCGTGCAACGACAGTACCAACGGGCGAGGGAACAAGTCAACGAGCGCCTGCTTGAAGCAATTCA
GGGACGAGCAGATCGGCATAGTGAAGATGTCCGACCCCACGTGATTCAAGCGGGCGAACGGGTGTGGCTATACCTTGATCGTGTGAAGGAGGGCTATGCG
CATAAATTAGCCCATATGTGGCACGGACCGTTTCGGGTGATCGAGATGGTGGATCATCACCCTGCACGTCTGGAGACAGCTGGGACGGAGTATCGACTAT
TCCCCGTTGTACACGTcttgaagcagaagctggtgcggGCGTTTCCCGACCGGCCCCATATCGAGCTGATGGGAGAGGATACGGATCGCTTTGACTTCGA
TGAGGCTCTCTTGCCGGAGGACAGCTGGGAGCGCAGTCTCAGCGAAGGCGAGTATGAGGTGGAGCGGATCGAGGATATACGGAAGGGTCGGCGCACGCGC
TACGGACACTTCCACTGCGAGTTTAAGGTCTACTGGAAGAGCTACGATGACCCGTCGTGAGTCGACAAAGCCGATCTTAGCTGCggtgcgctgctgcgcg
aatACGATCGTAAGATGACCACTCGCAATCGATTTGGGGTGATGCAGTCGCATGAGGAAGCGACGCAAGACCCGTAGCAGGTTGATGAGCACCTCCGGTC
AGCCTCCAATTTCTTCGCCAAGCGCACCCACTGCGGTGACGGCGTCTGCGACTTCCTCTGCCTCtcggtcttcttctccggTGACTGGCGTGCCCACCGC
GCAGATCGATCTGCCACCACTCGATCTGGATGCGATTCAAGCGTCTCTCACCACGATCCGTGGAGCGGTGGAACGCGTGGCCGCTCAGGTAGCGCTCGAA
CTGAATCACGCCACTCTCCAAGGGGCCTATCAAGCCGAGCGCGATCGCGCGGACGCACTCGATCGAGAATTGCGGGATGGTCGTGCGGCAGCCTCTCCCT
TCGTCCAGTTTTATCAGCATCACTACGACTTGGTACGTCACGAGCTGCGGGAATTGCGCATCTCACGGGCCGAGGCACTCGACGCTCTGGTCGATCGACA
GGACAACTCTCAGGATATCGAGTCCATCCGCGATCAACTTCGCGTGGAACGTGGCGCTCATGAAGAGAGCATCGCATATCTCCACACGCAGATTGAAGAA
CTCGGACGGCGCACGCACAGCCAATCCCCGCCCGGGCTAGCGCGCCGCATGTTGGCGTTGCAAAGCGAGGGGACCACGGCGGTTGCTGATGGGGATCGTG
CCCGACAAGATCTCCGTCAGATACGCGACGACATCACTGCCTATGATACTTCACAGAAGGCCCTTGAAGATGCTACCGGGCGCTTCCAACACCAGATCTC
CATTCTGGAATATCGAGTCAGCGATCTTCAGGCAAGCCATGATTCGGATGCCGCGCGCCACCGACGGCAGCTCGATCTGGCGTTAGGTGAGCGCGATCGC
TTCCATGATCGGGTTCGGGACGTCGAGGCCCAGTTGCATCAGGTGTCTGCCGATCTCCTTCCTCCTTCCTCCTTTTCTTGATCGGGATAGTTCGTAGCGT
TCCCTCACTCACTCGTTTAACATAAATTCCCTCCCGCATTAGCGTGCAGCCATCCGACACACTCTTCACTCCACTCCTCCCTGCGGCAGCCGCTGGGTCA
GGGACGCCGAAGGTGGTCAGGCAAACGAGGATTGTGGAATGTGCCCAGATCGGCCGCCGTACGGCCTCGCTGAGGCCCAGGGGACGGTTGAGGCGAAGCG
ACTGGGATATTTTGATGCGATCGGACTTGATGTGATGGATGGTGAC