Description :
From Genome Similarity Track
Location :
Scaffold_40:117051- 119360
Sequence
2309 bases(100 bases per row)
ACGCGCAGGCTGGGAGTGGAGAAGGAAGCCGTGCTGAACGAGCCATTCAGCACGCAATCACTGGACTTTGTTCCAGCGCCAACAAGCTGTAATACGGCTT
TTCCAGGACGCAATAGCAGCTTCTGTAGACAATGTCGGTAGAGGCAAAACAAATGAAGTTCAAAAGGCTTCATTAGCTCTGCTAGCTACGCAGAACCTAC
CACGACATGCGGTCTCCGACTTCGGTGCTAGCAAGCTTGATCCGCGCTTCATCGACCCGTTCACAATACTTTTACGGCATGGCAACGCGGATACGTTGGC
CATACCGTCAAGCATGCGACTCTATCCGACAATTTACGGCGGACGGCTGGATCCTTACGAGCAGCACGAGCCATCAAGTATTGGTGGCTCGAGGACGACT
AAGCGACGCGAGCCTGTTTCTCGAGCGCGACGACGCGGTCGCGCAGGCGCCTCAGCTCCGATCCAAGTGCGACTTAGATGTTCGAAGCTGTCTGAGCAGA
CGCAGCGACCTGCGCCTTTTGTAGGCGCAGCTCCTGTTGCAAGGCAACGAACACCACGCGCTGGATTTTTTCAGAGCGACGACACCATCGTGCAGAGCGC
GAGATCCATGGTTAACCTGGGGTTGACCATACGGAGGGTATCTTTCCTCCCCCGCCCCCACCACTGCGGGACGCGCTCGGCTCGACATGTTGAATTGTAG
AGTGAGTCGTGAACTACGAAGCCTCGAAGACGAACCGAGATCAGGCTCGTCTTCGTATTCACTGGAGAAGATTCCCTCCCGATCAATACATACGGGAGCC
ACGGGACGTCCTGATGAGAAACGTTCCGTCAAACTGGTGAGGGCGTACGAGACCCAGAGCCGAGTGCAGGCATAATGCCTGCACTAATACTGCGAGAACC
ACCAGCACGGGGTGGATCACGGTGCTCAAGTTGAGCACGGAGGTCTCACAGAGGAGCGGGTACACGTACAGAAGTGTACCCGAGAGCATCGCGCTCAAAA
AGGCGCGCTGCCCCGAAGCGGCAGCGCGAGCACGCAGTTTTAGGTGAGCTGCGCAGGGGATTCTTGCTTCCATTGCGTCAATATGGAGACGATCAATGAG
GTGACGTTTCGAGAAGGTCTCGAACGCTGTCGAGCCGCGACAATACGCTCGCGGTAGCCTTTCGTATTGCTGTTGAAATGCACAACAAATACGTTCCAAG
ACTGACAAAGTACCACCCAATCGGGCACTTTGCTTGTGCGCGAAGTCTTCTTCTACGCATTCCATCGGAGCTCATGGAAGTGTTCGATGTAATAGCTGCG
CCTTTGATTTGCTGACGAATCAAAGTGCATGTCGACGGCCTCAGCGTTATCATTGATGGCGCTGCACACGTACAATCCTATCGAGTTCGGCTGCGATATC
GCACCGATCCTGTCAGCGATTTTGGATGCAGTTGGCATCCAGGGAGTGCGTACTGCAGGTGCAGTGCGCTGAGAAGAAGGCGACACCGGCAATGGCGACT
GTGCCTTTTCTTCATTATGCGGAAGCTTCGATTGAGGAGCGTCCGGTTCATCGTCACGCCCACGCCACGACCCAACAGATAGATCGCGCTGGTTCGATAG
ACTTACAGTCGACAGCTGAAGAGGAGGTGTCGTCGTCTTTCATGGGGACGGCTTCAATGATAGACCCATAGTCAACGGGTATGTCTCCATCAGTAGACAT
AGCTGATGATCCCTCCATGACGACTGACGGTTTATCAGTCGTAGCTTGTGCCCGCTTTTGCTTAAGCATAGCGTGGTATTGCGTGACAGAAAGATTACCT
TTTGTCGCGGGCGTGTTCGCTTGCGCGGACACTGAAGGGATGGTGCCTGCAGATGCAGGCGCAGAGGTAACAGGGTCTGCTGGAGCAGACTTTTGTGCGG
GCGTCTTCCTCGGCGAGCTCATCGCGAAATAAGCTCGGGTTTCTCAAAGTATTGACGGCCTCGTCAATACTTTGAATGATATGTTAAGACTAGAGAAGTC
TTAGCTTAACGGTGGTGGAGTTGTAACGGGGTTACACGCAAAGTGGCTACACATAGCCACTTGATGTTTTCCGTGAGATACACCAATGACTACATTTGGC
AGACTGTTGGTCTGCATGCATTCAAGGCATTCATTGGTTGAAAGTCAATATCTTCAACCAATTAGAATAATAGGATTCTGTCGTTGATAAATACCCTTCA
TTTAGAATACTAAATTAGGAGGAAAACCCAAACAAACAAACAAAAACAGTTCTCATTTATACCATTCTTGATGTCAAGCTTCAGCCTGCCTGGATACAGG
TCTACTGGA