Description :
From Genome Similarity Track
Location :
Scaffold_60:117046- 122408
Sequence
5362 bases(100 bases per row)
CCCGTTATACCTGGTACCACTTTGTAGTCCGTCCAACGCTTATGAACATGTTGGATGATGAAGCGGAAGACTTGCATCCAACGCACGAGAGCTGCTCTCA
TTTGAGTCAAATCGAATAGGATGCCGTCGAACGTTTGAGCTCGACGATAGGGCAAGAAGCCGTAGGCGCATGCTGTCCGATCTGGGCCCAGAAGGGCAAT
AAGCCACCATCGCCAAGTTCATTCAGAATGAACTTGACGCTGAACGGAAAAGGTAGCCTTGCTTCACCAACAAGGGTCTCAACAGACAGAGCTGTTGAGG
CAGCAACAGGCTGATGCTACCGGGTTGACACACACACGTCGACCCGAATCGTTAAGATTGACAGCTCCAATATAAGTAGCTGATGAAGACTCGCTACTGA
GATGGTTTATCGAACCAGATGACGCCAAAAGGGCTCGCACATTGTTGATGAGCAAATGCAGGTCGTATTTGCTCAATCGAACTTGGCAGGACGTGCGAAG
ACTTGGACCTTGGGGCTCAAGCTACACGACCCATTTGTCTTTGGGTCGTTAGAAGTCTTCAGGTCCCAACTAAGGCAAACATTCGAACCACGCGATCTAA
GTTCAGGCTCGCTCTGCACTCCTGAAAATCAAACAAGGCAAACGTGATGTACACTCGTATATTCAATACAATCGTCATCTTACAAGTTGCATCACGTCCA
ATCCGCCTAATGAACAAACGTTGATCACATCATTCATGCAGAGACTCACGAAAGGTCCAGTCAGGCATATCTCTTCCGATTGGAATTTAATACCCTGGAA
GTGGCAACCCGAGTTGCGGGACAAGAAGATTTCAGCGTGAAACAAGCTCACGTGAGTTCGAATTCCTATCGTTATCCGAGGCGACAGGAAAGTGGAGGCC
CAGAACCAATGGACCTCTGTTACGCTGAGAGTAAAATTCCTCGCGTAACCAATTATAAGAAATTGCAGACATGCAATAGATGCAAAAGCCAGAGCATTAT
GCATACGAATGCAGTGCCTCGAACGCGATAACAAGGACCACAGGATACAGTAACCGTCAAGGGGCCAAGAAGCGTACGATGCGTGGGTCCGAAGCTGTTG
CGAAAGTGCAACACCGTAACTGACGACCAAAAAGCGGTCAGGGTCAGTAGGTGCGTAGCACCCTACTGATCCAGCAGCGTCAATTGAGTTTGCAGGCCTC
TTGACGAAAGTTGCTTCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGGTAATGAGATTTCCTCATTACCTTGAAACTCGGAGTGACAAACGACATGTC
ACTACGAGCCCTGGTCGATTGGGGGGCGTCAAACAACTCTGTACGACGCCAGTCGTTAGACGACAGCAAGCTTAAATTTATTGAGCGCAAGATCCCTCCA
ACGAGGATGACGGTACGCCTCGCGATATGCGCATCCGTGACAGTGATGCAACGTGTAGTGAAAATCACCTATACATTGAGAGATGTGAAATATAATGATG
ACCTCATCGTTGGACTTGGACGAAAAATTTGATGTTATCCTTGGTTTATCGTGGCTCAGAAGGTACGAGCCACAATTTAGCTGGCATCGACGAAAGGTCG
ATATCCCTGTCGTTTGGTTATTAAATGGTCATCTGATGAACGTCATCATGGAGCGCCAACTAGCATGTGGGTGTACTACGTGTGAGTGCGATGGCCTTAC
ATGTGGTTCGGTCGTTAGTACGACTGCACATGACCACAATTTGACTGATCGTTACACTGTGGAGCAAGGTTCCGGCGATTGTGTAGAAAGCAGGTAGCGC
CGAAGGCCCAACACCCTAATTAGTCGAGTGGATCGGGGCATGGGTGTTTTTCAAACGGTCAATACCCAAGCAACAACAAAACTTTTGCCAATGATTGGCA
ATACGATAATCTTAGATCGATTGTAGAATCGAATGTAGAAGACCTGGCCAGGGTAGCACAACCACCGCCAGAAGAAGTCGAGGGAATAAATCCACTCATA
ACTAATGATCATATAGCTCACGAGACAAGTGTGGAAAAACTTCATCTACCAACTGTGGAATAAATTCCCAGAAGACTACAGAGACATTGAATGTCCTATT
CAATGACGGATCAAGTATAGTTACCTAGAAACATGATCTAATCGCGCCTCCAAAGTTAACTTCGGAGGTCACTCAATTGCCCACTCTTGGACAGAAGAGG
TTCTTCCGTGTTCTCCGTAGAGGCAAATTCAAGCTGATCTGCGTACTCATCCCAGAGGACGAGTATTTCACCGATATCCGGTCGGCAATGGTTTTTGCCA
AGAATGAAGGGTTCTCATAAGCTCATGAATGGACGAGAGTGTCCTTGATGAGAAGACACGAATTGAGCGATGTACATCATAGTCGTGGGAATCGCTTAAG
GCAAATCCTCTCTACGATGATTTGGTCGAACCTAGGGATTTTTTCCCAGAAACAATGCTGTGCCAGTTACTCAAGGATAAGGGTACTCGTTACGCTATCG
GCCTGAAGCGGGGGGTCGAAGTACTGCGTCATGAAGCAGTTGCCAATGCCCCGTGAATAAGTACTAGCGATCGACAAATTTTTTGCCGATCGTATAGCAG
CGGGACATGTGAGGGAGTCAACTTCCCCACAGAGATCTCCGACCTTTTGTGTGCGCAAGACTACAAGAGGATGGCGGATAGTGCATTCATTCAACAAGTT
GAATGCTGCAACGGCACCGGCTCAAACGCCGTTACCAATAAAAGATGTCATCATAGATGGCATGGCAAAGAGTATCATCTTTTCATCAATGGATCTGATG
GACGGGTCTATCATATCCTTATGCGCGAGCGGGACACCCCGTATACAGCAGTGAGCACCCCAAGCGGTATGCTCTAGGAGTGGCTGGTGATTCCAAAAGG
GCTTAGCAACGCCACTGCCACATTCAACAGATGTGTTTTAAATTTATTCAGACCGGTGCGAGACTTCGCACCCAGTTACTTCGACGATGTAATCGTCCAT
ATCCGGGATATGGGTGGACAGACGGATGTGGAAGTCCACCAACTCCACGATCGGAAGGTTCTGCGCAAGTATAAGTTGTACGTCAACCTGAAGAAGTGTA
TATTTGCTGCTAACAAAATACCACTTCTTGGGCGCATCGTGGGTGAACATGGCGTCCGGCCCGATCCGGAATGATCAACTGCCCGGTGCCAGTAGGTGTG
AAAGAGCTTGGAAAGTTCCTTGGCCTAGCGGCGTACTTGCACAAATACTCCTACACGGACATAGAGATAATAGGTCATCTCTCTCGTTTATTGAAAAAGA
ACGACAAGTGGGTATGGAGTGCTGGTTGTCAGCGCTCCTTTAAAGGTATCAAGAAATGCTTGATACAATGGCCAGTTTTAGAGATTGCAGGCCAAGTCAG
GCCATTTATGTGGTCTGTGATACCAGTGATTGTGCATCGGCTGTGCATTAAGGCACTACGGTGCAGAATGTGTGGAACGTGTCTCTTCTATCAGTCGCGT
CAGCTGCAACCAGCTGAACGTAACTACCCCGTCCATGACATAGAACTCCTTGCCATGAAGAACGCGTTGTTGAGATTCAGAGTATATCTGTTAGGTGAGA
GACCCTTGTTTGTCTATACGGACCATGTTTATTTAAGCACGGCCGTAAACAGTCCACACCCCTCGCAGCGCATGGCGAGGTGGCTGTCATTGGTCGCGGA
GTACAGTTTCTCCGTAGAGTATGAGCTAGGACGACTGAATGTCATTGCTGAAGCACTGTTGCGCCGGCTCGATTTCAAACTGGCTGCGCAATCCGACACT
AGTCCGACCACTGTTGCGGTATTGAGTTCAATTTTCCTGTCGTTAAACCTTCTGGAAGCCGTACGAAAAGCGCATGATCTGGAGATGGTGCTGTTGATGA
ATCATATCTCGCAACCCTCCCATCAATCCCTTAACCAGTTGGCGACAGTAAAACGAACCTCTACGTATTGATATACAGTTCGCAAAGGCTTACTGAAATA
TTCTGCTGCTGCCGCCGGTGACACGCCTCGTTTCGTCGTACCTGATCATGATGGTTGCGCATCGTGTATGAGTACCAAGACGCACCTGTTGGTGGGCATC
GTGGTCGTGAGAGACAATATCTCACAATGAGCCGCGACTTTTACTGGCCCCGCCGGTATCATTGCGTGCGCAAGTACGTTCGGGCCTGTAAGGTCTGTCA
ACGGGTGAAGCCTAGTTCGTCGCTTCGGGCCCCGTTGTAGTCTCTGCCCATCCCGGCTGAGTGCTGGGAATCTGTCTCAATGGACTTTGTCTTTGGACTC
CCCGCAGACTCCCACAAGAATACTCGTATTCTTGAGTTCGTTGACAGATTCACCAAGATGGTACATCTGGTTGCTGCACCTGAATCAATCAATTCATCGT
CTTGTGCTCGTGTCTTTATCGACGTGGTCTTTTGCCTTAATAAGTTGCCTCGTGAGCTCGGGTCCGATCGGGACCCGCGCTTCAAAGCCGAGTTTTGGCG
TGCCGTGTTCAAAACACTCAGAACGCGCTTAAGGATGTCCACGTCTGACCACCCTGAAAGAGATGTTCAGAACGAACGCTCCAATCGTGTCCTCGAGAAG
ATCCTTCGAGGGTACGTATATTCTTTTACGAATTGGAGTGGATTCTTGCCGATGGTGGAGTTCGCCATCAACAATTCAGTCCATGCAACGACGACACTCA
CGCCGTTCTTCGTAAATGGCTTTCGTCATCCGCGTCTTCTCCATTTTTAGAGTATGACTGTAGTTTAAGGGGGGGGGTCATTGGAGTGACTGCCAATCCG
GCTCTTACTCGTCACGTGCTGACAATGTGGTCACAACGTTTGACGCCGATGTCGATCAAATCAACTTTAGTGAAGAAGAGGGAAGTAATAGCGAAGATTA
TCTTTTTACTTTAACGATACTGTTTTAATCAGCAACACTCCTAGTGCATCCAAACACACACTCGCAGAGGCGACAAATGATATTGCTCCAGTACACTCCA
AGAGCACTGTAGCTAAAGACAGCGCGTCAGCAGATAAATTCATACTGGATAGCGAAGCGGATGTTTGGTTTGGACAAGACTCTATTGCAGAGGCGGTAGA
TCGACAAAAATGAAACGCTGACAAGCATAAAACGACAAATGTTCTTTTATTCAATGAAGGAGACTTAGTCCTACTATAAACAGTAAACCGACCTCGACAC
GTAGTGACTAGCGTGGGTAGTAACTTGTTACTACGCAGGTTCATTGGTCCATTTTGTGTACTGCGCCGCCTAGGCAACGCACATGCAATTCAACAGTTAC
GTGAGATGCGCACTCATCCGACGTTTTACTTTGGTCGCCTTAGGCCGTACTATCAGTACGGG