Description :
From Genome Similarity Track
Location :
scaffold_668:11704- 13413
Transcript NameFunction/comments
g9781.t1hypothetical protein

Sequence
1709 bases(100 bases per row)
CCGTGTACGTTGAGTTGGAGCAACCTCACATACACCGTCGACTCCAAGAAGGGGAAGAAGACGATTCTCACCAACGTCACTGGACGTTGTGCACCTGGCG
AACTCACGGCCATTATGGGGCCTTCAGGCTGCGGTAAAACCACGTTACTCGACATTTTAGCAGATCGAATCTGTTCCGGTACAATCAAAGGGGAAATCGC
TCTGAATGGAGAAAAACGGACTGAAAAAACCTTCCGAGCTGTATCGAGTTACGTCGCTCAAGAAGATTCTCTTTTGGGGTCTTTCACAGTGTTGGAAACG
CTCCAAATGGCTGCAAAATTAACGATGGCGAATTGCACCAGTGCCATTTCCCTTCTAAAGCGCGTCCAAAGCGTAATTGACGACATGGGGCTGCGTGTGT
GCGAGAACGCGATGGTAGGCGACATGTTCCACAAAGGGATCTCTGGCGGCCAGAAGCGACGACTTAGTATCGCCATTGAGATGCTGTCGGACCCGTCGAT
TCTTTTACTGGACGAACCAACGTCCGGTCTGGACTCGGCGTCCACTTACAACGTGATTAAACTCATTTCCCGCTTGAGTCACGAAGGCCGAACGATTCTC
TGTACCATCCACCAACCGTCGTCTTTGGTGTACGAAATGTTCGCGAATGTGGTGATCCTCACTGCCGGACGCACCGTTTTCTTCGGTCCACGGAAGAAAA
TCCTCCTTCATTTCTCCTTTCTCGGCTACGACTGCCCTCAGTATCAAGATCCAGCCGAGTACTTCATTGATCTGGCGAATACGGACTTCGAAGGCCACGG
AGACATCGAGAAACTCGTCAATGGATACGCGTCCAGTGCAATCGCTTCTCGTGTTGTCAGTGCAATTCGTACGGATGCATCGGGGGTTCATGCTTTACAA
TCCATGAAATTTGCCAAAGTTTCACCCACTCGACAGTTTTTCGTGTTACTACACCGGAATTTACTGAATAACCTCCGAAATCCGGGAATTTACTGGATCC
GACTGGTAACGTACACGGTGCTGTCCTTCATGGTCGGGACAATGTATCTGTCCTCCAACCCAAAGATCATCGCCACTGACATCGTGATGCTGCTCACTTA
CGTCAACATCTACCTGGTCTTCCTCTCGATTGCTGTTTTGCCCTTTTTCGTTGAACAACGGTCCGTTTTCCTTCGTGAACGGACCAACAGCGGAGTGAAT
GTGTTGAGTTACGTGGCTGCCAACTTCTTGGGTGCTTTACCGGGGATTTTCCTCATCGCGTTGAGCTCGACGATGCTCGTGGGTTATTTAGCGGGGTTAA
ATTCGTACGCGGTTTTCCTCCTCACTGTTTTTCTCTCGCTTATCGTCGCTGAGAGTCTCATGCACTTGATCTCTGTGGTTGTACCACAATTCATCATCGG
AATGGCGTTGGGGGCGGCGATTTTCGGGTGGTTCATCTTGGTGATGGGGTTATTCGTCCCCGGTCCTGCCATGCCTAATTACTGGCGGTGGTCACGTCGT
CTGGGGTTTCTGTCGTACAGTTTCGAGGTGCTGCTTTACAACCAGTTCAGCGTTGATGATTCTCCACAGAGTCAAGCTGTGTTGGCCAAGTTTAGATGTG
ATGAAGTCCATGTTGGAAAGGATATGGCCATATTAGCAGCCAACGCAGTAGTATTTGAAGTGGCATTCGCTGCCATTCTGTACAAATTCCACACGGGTCG
ACGGTAGAA