Description :
From Genome Similarity Track
Location :
Scaffold_14:1170348- 1171865
Transcript NameFunction/comments
Aphas_H257_06449myosin-like protein
Aphas_H257_06450ATP-binding Cassette (ABC) Superfamily

Sequence
1517 bases(100 bases per row)
AGGACGTTGTACACGGTCCTGGCTGGGATTTTGCACTTGGGGGAAATCACGTTTGTCGCTACGTCCGAGACCACGTCGGCGGTGGACAAGAACCGAAATA
ACGCGTTGAACCAAGTGTCGGACCTGCTGGGGCTCCCAGTGGACACGATGGAGCAAGCGTTTTGCAACCGCACGATCGCTTCGAACCGGGAAAGCGTGAC
TGTTCCGTTGAACGCGATCGAAGCCGCCGAGAACAGAGACGCGCTGGCCAAAGCCATCTACGCCAACATGTTTGAGTGGCTGGTGCAGCGAATCAATGCG
GCGATTGCAGTGGACTTGACGAGCGGGACCGAGATTGGCGTGCTCGACATCTTTGGGTTTGAGGACTTCAAGCACAACGGGTTTGAGCAGTTTTGCATCA
ACTATGCCAACGAAAAGCTGCAGCAAAAGTTCGTCAAGGACGTCTTCTCGACCGTGCAAGACGAGTACGTGCGCGAAGGCCTGGCGTGGGACCACATTCA
GTTTGCAGACAACCAGGACATTTTGAACGTGATTGAAGGCAAAATGGGCATCATAAACCTCATGAACGACCACCTTCGCCAGCCCCGGGGCACGGAAGAG
GCGCTGGTCAACAAGTTCCGGACGAACGCCAAGGACACGGGCGTGATTGCGTTTGCTAAGGTCAAGCGTACGCAGTTTACTGTCAAGCATTATGCCGGCG
CCGTCACCTACGAAACGGTTGGGTTCATGGAGAAACATCGGGACGCGCTGCTGCCGGATCTGCTCACGCTGGTGCAAACTAGCTCGATGGCATTTGTCGT
TGATTTGTTCTTGAGCGACGACGACAATGACACGACGTCCAGCTCGGGGAGTTCGTCCCCGAGGGAGCCAACAGTGGTCCCGCCCGTGATCCAAGCATGG
AACCTCCGGCGCAAAGGAAGTCCGGTTAGCACAAAGCCAGAGGATACAGTGGACAAAGCGTTTGGGGGTCGACGGAAGGCCGTGCCTCCGAAAACGCTGG
GGCAGCAGTTCAAGACATCTCTTTCCAAGCTCATGGACACGATCGAAGCGACAAACGTCCACTACGTCCGGTGTATCAAACCGAACGCGGTCAAGTCCCC
CACAGACTTTAACAAGCCCATGGTCGTGGCCCAGCTGCGGTCTGCCGGCGTCATCGACGCCATCCGCATCTCCCGAGCGGGGTACCCGAGCCGGCTGTCG
GCCAAAGAACTGGCGACGCGGTACGCGCTCATGTTTCCGCCGTCGATGGTCGGAAAAGGAAAGAGTGTGGACGACACATGTGCGATGGTGCTGGCCAAGA
TGGGCTTCCAAAAGCCAGTCGAGTACCAGATGGGCAAGTCGCTCGTGTACTTCAAGGCGGGGGTGCTCGAGGAGCTTGAGACGCTCAAGTCGGACTTTGA
GTACCAACAGGCCACGATCGTTCAAAAGGTCGTGCTCGGGTTTCTGGCGCGGCGCAAGTTTGGCCGGCAGCTGCGGGCGGCGGTGACCCTGCAAGCGTTT
GGGCGGCGGGTGCTGGA