Description :
From Genome Similarity Track
Location :
Scaffold_143:1170- 5253
Transcript NameFunction/comments
g8411.t1hypothetical protein

Sequence
4083 bases(100 bases per row)
ATGTTCTCATGGTGAAGGACAAGACTACCGTGTACGAAATCTTTCAGACGCTCTGTAGCAAATCCGAATGTGCTGCCATCCACGGTGACCCGTACTACAT
CCAGTCGTACCTGATGGCTCTCAAATACGAGGATGGGTCCGACCTCATCGCTTTCATCATTGACTTGGAAGAATCTATGAAGGCAGCCGCGGAAGCCACG
AACAGTGTACTGACCGACGCGCACAAATCGCTCTATCTGTTTCATTCCCTTCCAACGGAGTGGAAGCCTGAACTAGCAGTCTGGAAGGGCAGTAGTAAGT
TCATTCCGTACGAAGATCTGAAACGGCACATCGAGACCAAGGTCCAGAATGAGCTAACGCGCAATCGCTACATACTCAGACAAGGAACCTCAGAGTCTAT
AGAAACACGAGCTGAGAGAAAAGTTCAATCCACAGCACCGATTCCGATGCCAGCGGATCTGCAAGTCCCCGCCAAGATGGAGACAGCTGTCGTGGTTTCA
TTGAAGTGCTCGTACTGCCAGCGCGACAACCATGACACAGTTGACTGCTACATCCTGCAGCGTCACCTACGTGGTGGTCAAATCAAGGCTGGTACGGTTC
TTCCCGCCAACTTTAAGCTCAAGGCACGCAAAGTCATCACCCTTACAAGGGCAACTACCAGGGAAACCGTGGCAACAACTCGTGGGCCAATTACCTTGGT
CGTGGAAACAACAATCGTGCTCCTAACGGAAAACGACAAGATCGCCGTGGAAGTCACAGCCGCAACAACCAAACAAAACAAAACGAGTTTCACGGTCGGC
GCAACCAAGACACCCATGGATCCGACAACAACGAGTATGGCATAATTGCTATTACAACGCTCGATTGTTGCCCGAAAACTGTGGAGGTGGGTCTCACTGC
TCATGTCGGACTCCAGGATTCATCATGGACGATTGATTCCGGCTGCACTCGCCACATCACGTCCAACAGGGAATGGTTTGTGACCCTAGAACCGACCGCG
GGCAAGTCCATCACGGTGGGGGGCAATCACCATATTCCCATTGCTGGAACAGATGACGTGAAGCTAACCATCAAAGATACGAAGGGAAGATACCAAGTCA
TTACCCTGGTCAACGTGCTGTACGCACCTGATCTCAAGTTTAAATTGCTCTCGGTCCGTCAAGCTGTCGAAACGGACTACAAGATCAACTTCCCGAACAC
CAAGAAATGCGTCCTGTTCTACGACCGTGGAACCAAGTTCGAAGCCAAGACTGGCAATGGCACTCGCTTCGACCAATTCGTAGCTCGCCCGGTGAGCATC
GACCACGCAGCCCATGTGGCCAAATCTGGTACGTCCGATAATATGTTACTCTGGCACAAACGAATGGTTCATCCTAACTTTCGTATTATGCGGGATCTGG
CTAAGTTGGACGCCATCACAGACATGAGGATGTCGAAATCCGACTCAAGCAAGACTACTTTTGCTCTTCATGCACATACACTACGGCAAGGCACATCATA
ACCCAGTCAATAAACGTACCGTTGAAGGGCAAAATCCCCTCTTGAAAAGGTTCATACAGATATGGCTGGGCCCCTTCCTGTGCCAACACTATCAGGCTGT
CAATATTTCTTGACCTTTATTGATGACTACTCGCGCAATGTGTGTATCTACGTTATCAGGCGCAAGTCAGACCTGTACGTCTGGTACGAGGATTTCAGAA
AGAAAACACAGAACATGTTTCGCGCTGATGTGGTTCACTTAGCATACCATGCTGACATGCACGATGAAGAGATCCGGAGCCTCCAAAGTGACAACGCTCG
TGAATATGAGAAACTCGGGAGAATTATCTTCGAAAAATATACACACACACACAGTTCATAAATGCATACACACCACAACAGAATAGCGTGGCAGAGAGGC
GTATGCGCACACGTCTTGAAAGAACGCGAGCATTTCTGGTTGACGGAGATCTTGCCCAACTCCTTTGGGATGAATGCAACACACACGTCGCTGATCTCCT
CAACGTGACCCCGAGTTCGGTCACAAACAGCGTTACCCCCCCCCCCCCCCTATGAAAAATGGTTCAAAAAGAAACCATCAGCACATTACATTAAAGTGTT
TGGCTGCACGGCATACGCTCACATCCCAGAGCTATACCGCAACAAACTCGACAAAAGGGCTAGAAAATGCATGTATCTGGGAATTCCATCCGACAAGAAG
GGCTACAGGCTCCTAGATACGACAGATAATCGCATTGTTTACAGCCGTGATGCTCCCTTCCGCGAACATGAATTCCCCACGCTGGATTTTCTCGATTTAC
AGAAAACAACATACTTACTTAGTCCTAAAGCAGGCACTGCAATTATAGTACCAGCACCCAATCGCTTGCCCTCGCTGCCAGCAATGCACTTGCAGCTGAA
AAAACAAAACCAACACCTAAGAAAGCAAAACCTTTCTCAGAAAAGAAAGCACATACACTGATCCAGTAACAACTTTACTAAATGGTACTCTCGATCTAGA
GGAACGCGAAACACGTCTCACTGCCCTCTACACACTGCTTGACATCAGGCATATATCGAAGCCAAAGACCTACAAGGCAGCCGTGCATCTGCCAGAAGCT
TCTCACTGGAAAATAGCCGCCCGATCTGAGTACAAGGCTCTCATGGACAATAAAACGTGGGTAACTGACCAAGTTGCCTAATGGCAGACGTGCATTGCAA
TGCAGGTGGGTATTTATCGTCAAATACAAAGGCGATGGCACAATAGATCGCTACAAAGCTCACCTAGTTGTTAAGGGTTTCCTTCAAAGATACGGAATTG
GCTACGCCGAGATTTTCTCCCCTGTCCTCCACATGGAAGTCCTACGACGGCTGCTTACCATCGCTGCTCTATTAAATATGGAAATCCATCAGATGGACGT
CAAAACCGCATTCTTAAATGGGTACGTGGATGAGGAAATATACATGGAACAACCTGAAGGGTTATATTGCCGAGGTAAAGAACGCCTCGTATGCAAACTG
TTGAAGAGTCTATACAGCCTCAAAGAAGCCCCTCGAGTCTGTTACTTGACACTGTGTGACTACTTAGCTACGATGAAGTTTCGCAAACTAGCAAAACACC
GATGCGTCTTTGTAGGGAAACTGACGGAAAGACATGTTACATTCTTGTCTACGTCGATGACCTTCTCATCATTGCACCTAAAGTCGACATTGTCACTTAT
ATCAAGAACGCACTCAAACAGCGCTTCAAAATGTCCGACCTGGGCGAAGCCCAATATGGTGCGTTGTACGCGATCGTAAAAATCGCTCCATCTTCATACA
CCAAAAGAAATACGCTACCAAAGTCCTGGACCGCTTCTCCCATCTAAACTCATATCCAGTGGGAACACCCACCGATCCGAGTATCAAACTCTCTCTAGAT
ATGTGCCCACAAATCCCTTCGGAACGCGATGAGATGAAGGCGATCCCGTACAGAGAGGCGGTCGGTAGCTTCGTGTACCTGGTAATGGGAACTAGACCAG
ATCTAGCTTATTTTCTACGAGAAGCCAGTCAATTTCTGGCTAATCCAGGAAAACAACACTGGAATGCGGTTAAGAGAGGTCTTAGATACCTAAATGGTAC
ATGTAACCTCGGCATTACCCTTGGAGGAAAAGAAAACCTAGATCAATATAACACAAAGCACTACCTCGCAGCTTTTCAGATGCAGACTATGCTAACTGCG
CCGACACACGCCGTTCTGTAGGAGGATATATTACCTAGTCCAATCTCTTGGCAGTCTAGAAAACACCACACAGTCGTGCTATCCACAACGGAAGCAGAAT
ACATCGCACTATGCCACTGCATGCAGGAAGTCATCTTCTTAAAACTCCTAATGATAGAGGTAAACCACAGTAGCCCACATGCCATCATTCTCTACGAGGA
CAACCAGAGCTGTATTAAACTCTCATATAACCCAGAACTTCATGGTAGAAGCAAACATATCCATATTCGCTACTGCTTCGTACAAGAAAAGGCAGAGCGA
AAAGAATTCGAGATAAAATATTGTAACACTAAGGAAATGGTGGCATATATATTCACCAAGTCACTCACAAAGCCGACTCTTCT