Description :
From Genome Similarity Track
Location :
Scaffold_1985:117- 3226
Sequence
3109 bases(100 bases per row)
GATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTGGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGGCCAAGACTCCCAGGATCTCG
TCTTCCCCTTTCGAACATTTCACGATTTCCAGTGTCCAAGGCGAGAGTAAGGCTGCCCACTATCCCAACCGTCCTTGTAAACCGGCCGACTTGAACAGCC
AGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTC
CACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACAAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAAGGTCGCTGAGACT
GCCCAGTCACTGGCATAAACTATCACCGTAGGCTGACGCTCTGGATCGAAATGGCGGAGGAAGGGCGTAGTCGCGATCCTGTTCCTCAGCTCCATGAATG
CGTGTTGAGCTCGGATCCACCGAGGTTCCACCTTTTCCGCGTTCTGATCCGTCGTCTCTATCCAGATTGGATCCTCTTTCCGTTGGTCCCGGGGTGGATC
CAGCTCCTGTTTTAGGTCCTCTTCTGACGTCGTACTACTTGGATCCCTTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACA
GCTGAAGTGGTCATCGCAGCAAAATTTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGTGCGTAATCCTCGATGAACCGGCTATAGTAGTTTAAAC
TGCCTAAGAAGGATTGCATGTCTCGTAACGACTGTGGGAAGAACAAGCCTGCTAGCGAAGACAGGTCCTTAGGATTCGCTCCAATCCCTTCTTGGAAACT
CGATGGCCTAAGTAATCCACCTTGCGCATCCCCCCATAGCTCTTTACCACACTGATAGAGAGATCCCACTTAGTACACGCCTCCAGTAGGGATGTCACTC
TTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCTCAGGATCCTCTGGCTCTCT
CGCTTCGAATGGATCCACTTCTGTATGGTCTTCCTCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCATGCGT
TGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGGTCCG
TCATAGTAACCATCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGCACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGAGGCATCGGATA
CACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCAC
GGGGACGTTGAGAAGCTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAG
CGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCA
GATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCC
GGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCAGCCTTCACGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTG
GATCCAAACACCGCGGCCCTCTCTCGACTGGCAGTCCTTCTATCTTCGGGGGTTCGGGTAACCTGGTATCAGGGAAACCACCAGTTGGATTCAGTTGGTC
CTCTAACGAGTTTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGT
GGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCATCCCCCGTCC
TGGATCCAACTTCCATTGCATGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATAGGAAGGCCGATCCACCAAGGGGCCAGTTGG
CTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACA
TACCCAGGTCGTCTAGGGATACCGGCCTTCGCCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGA
GGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGGGTGACCCACAGTCTTTCATGTTCCGCCCACTTTGACCGGTCTGG
CAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCCTATCCGCCCTCATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATC
CGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGA
GATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAGTCCC
AACACAGTCTTGGATCCGACTTCCATCCACTTGGCACCCAACCTTACGAGCAAAGACGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGG
ATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTTCCCTTTTAGCA
GATCCATGG