Description :
From Genome Similarity Track
Location :
scaffold_1454:117- 2811
Transcript NameFunction/comments
Pl_100660putative gag-pol polyprotein

Sequence
2694 bases(100 bases per row)
GACGCCCAGGCTCGCAGCTACAGGTAAAACAGGATATGTTCCTCATATGGTATAACAGTCTTGGTCACCCTAACCTCCGTCTCATACAGGATATGAGTGA
AACGGAGGCACCCACGGACCTCCATCTAGCACAGGACGACAAGACGTATTTCTGTAGCTCATGTGTGTATGCGAAATCCCACCGCACTCCCTTCACTAAA
ACACCTATCCTATTGAACGTGCTAAAGCTCCATTGGAAAACGTTCACTCGGATATGGCCGGCCTCTTTCCGGTTCCGACTTTATCTGGCTGTCAGTACTT
CGTGATGTTTATTGACGAAATAAAACGGAATTGCATGACTGCTATGAGTGCTTCCGGCAAAGTGCTGTCACCCTCTTCCGCAAAGAGATCCCACATCTAG
AGTATCGGACCAATCACTTTGACCCGGAAATCCAGGTACTATAGTCTGATAATGAAAAGAATATGGGGCATATTTCCCGAACATATGGCACGCATGCACA
ATTCACGAACGTATACAGCCCGTAGTAGAATGGGGTTACCGAGCGTCGCATGAGAACGATTCTCGAACGTACTCGAGCATTTCTTATTGACGGCTCCCTT
CCTCAGAAGCTCTGGGGCGAGCATGTTACCCATGCCTGCACCTTAATCAATATGACACCCATCACAGCCACGGGAAGTGAAATCCCATACGAAAAATGGT
ACCACCGCAAATGATCCTCTCAATATTTTAAAGGGTTTGGTTGCAGTGCCTACGCACATATTCCTTCCGCCCAGCAACAAACCCGACCCTCGAGCGCTCC
ATTGCTGCACCTAGGGCTCCCGCGGAATAAAAAAGGGTTCCGCCTCATGGATGTCGTTACTAATAAGATTGTATACAGTCGCGATGTTATATTCAAAGAA
GATGAATTTCCAACTCTGGCGAATGTTACACCTGCAGTTACGCCAACTACACTATTGATTTCACGCTGTTATCACCACTTCGCACCATGGTTGGAAATCA
CCTTCAGAGCGCTCATATTGGCACAGTGTGTATGCCTCTCAAGCGGTCAGCAGACGACAACCCTGCTTCCGACCTACCATTGCGCACGAATAAACGTGCT
CAGCTCTCTGACACTGATCCCACCCACGTTTACCTAAATACCCCAGCCGACCTCTCTGACATCGAGCAACGTCTCCAACACCAATATGTCCTCCTCGCTC
TACGCCATGTATCCAAACCAAGAACCTTCCAAGAGGCTCTGCGCTCCGAGCACGCTTATAGTGGTGCCGCGCTCCGGGAGCTGAATATCAGTCGCTTGTT
GACAGCGGCGCCAGGAAGCTGGTGCCATTCTATATTGGGCTACCGATGGGTGTTTATTGTCAAGTACGGCGCAGATGGCCAGGCAGACAGTTTTAAAGCT
AGATTAGCAATCAAAGACTTTCTTCAGCGCTGTGGCAACGACTATACTGAGATTTTCTCTCCGGTTATCCAAATGGAGGTATTACGGTTACTCCTCACCA
TTGCTGCACTACTAGACTATGAAACCCATCAAATGGATGTTAAAACTGCCTTATTGAATGGTTTTATTTACGTAGGCATCTATATGCATCGGCCTGAAGG
TTTGACCCCCCGGAATGGAGAGCAAACTAGTCAAAAGTCTGTATGGGCTTAAACAAGCGCCACGTATATGGTACCATAATCTGTGCACATTCCTATAAGA
ACTCGGGTTTATCCGTCCTATCAAAGACCGTTGTGTCTTCATGAAGCTCTAACCAATGGGCCTATGCTACATCGCCGTCTATGTAGACGACTTACTGATC
ATTGCGCCAACACCAGACCTCGTGGAACGGGTCAAATATTCCCTCATAAGGCGCTTTAAGATAACAGATTTAGGGGAGGTGGCATACTTACTCGGCTGGT
CAATTGAACGTAACCACTCCCGTAGAACTATATTTATCCATCAGCAGAAATACACTCATATTATTTTGAAGCGATTCCAACAGCTCTCCTCGCAACCGCT
TGCGATCCCTTGTGATCCTAGTATTCGACTATCAAAGAACATGTCGCCTCAAACAGAAATTGAAAAGGAAGAAATGCGCAATATCCCATACAGGGCGGTG
GCAGGGAGCTTTATGCATTTAGTCGTGGGCACTCGCCCAGATCTCGCATACTTTATTCGCGAAGTATGTCAATTTCTGGATAATCCTGGGAAACAACATT
GGAAATATATTCAGAGAGTCCTCCGTTACTTGAATGGTACAAGGCGGCATGGTATTTTACTTGGCGGAGAACGAAACATTTCATCTAAGAACACAAAAAA
TCTTCTTACGGCTGATTATGCAAACTGCCCCCGACACGCGACGATCCGTCGGCGGCTACATCACCATGTTAGGACGGAATCCTATTTCATAGATCTCCAG
GAAACACCATACAGTAGTTCTATGAACCACAGAGGTTGAATATACTGTCCTTTACCACTGCCTAATTCTTCCGCCTGTTACTTAACGAAGTAGCCTTTAA
TACACAGAAATGTATAACTATAATGGAAGATAACCAGATCTGTATTGAATTCGCAAATAATCCCAAACTCCACGGAAGATCTAAGCATGTAGAAATCCGT
TACCACTTCGTTCAAGAAAAAATAGAACATCAGGAATTTATGATCAAATACTGTTCAACAACTGACATGATAACAGACGTTTTCACTAAAGCTC