Description :
From Genome Similarity Track
Location :
Scaffold_1134:117- 2221
Transcript NameFunction/comments
g14111.t1ETO58721.1 hypothetical protein F444_22899, partial [Phytophthora parasitica P1976

Sequence
2104 bases(100 bases per row)
CACATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGCGATCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACC
ACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCTGAAGCACACGATCGTGCGCTTCGTCCAGTCGATCACCGGA
TCATGCCGTGCAAGCCACGGTATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGGTAAGAGA
AGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAG
CCTTGAAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACA
AGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGGCTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCAT
CACCAGCAGGGCGCCCCGCGCCTGCTAGTCCCTTTAGTTTTTTGATTGCCGTGACGTAACCCCAGTATCTGCACGAGGCTTCTCGCCGCGTGACAACAGG
TGCTGTGCACTCGCGGGGTAGTGACCGATGTTTCTGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCG
AGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATTAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTC
TTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGATCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTG
ACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCA
GATCGAGGAACTCTGCCCTCGATTGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGG
ATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATATGTCGAGCC
GTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTTAATGACTCCACGCGCGGTG
TGGCGATGGCGAACACGAAGTTCGAGGGAGCGGTTTCACGCTGGTTCCTTCCGATGAAAAACCCAGAGCAAACACCGTGTTTCGTCGGGATAGCGTTCGC
AGACATCGTTGCTACGCGCTTCCGCATGACTGTTGACAGTCGTTGGAGGCCTCCGCACTCGTGGTATGCGAAGGTGGGCAGTCTGCACGGCGCAACATGC
GTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTG
GACGGACTACAAAGTGCTACCAGGTGTAACGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAGTTT
ACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAA
TGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGTCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGT
GTTACTTCCTACCAGTCATATGGCTTTGGTCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGA
GGTG