Description :
From Genome Similarity Track
Location :
Scaffold_1404:117- 1501
Transcript NameFunction/comments
Phypl_g13331hypothetical protein

Sequence
1384 bases(100 bases per row)
CACCTCTGGGCGAAAAAGGTTTCATCGACCTCGCCACAAACATGCACCACCGGGTAAAACCTATACCCACTCCGGTCGGGCAATTCCAACTCGTACACAA
ActcctcgaccttctccttcacaCGGAATGGCCCGTGCCATCGGTGGGCCAGTTTCTTGGTCAGTCCCGGCTTTACACGTTCCATGTACAGACAGACTCT
GTCCCCTAGTTGGAAAAGAGACCTCGGTCTCGCGTCAGGAGCATCGTCAGCTGCCCCTGTCTCCAATGGAGTCTCGTCCGACGTCACGTTCTCATCACCA
GTAGGCGGTACTGCCGTTCGTTGTGTTCCTTCGCTCTCCGAGCTTTCTCGGTGGCCTGGTATTCCATAGCCATTCTCCACGAAATCTCCTGCTGTCGGTT
CACCTCTCGGCGCCATGCCAGAGCATCGGTTTGACCTCCAGAACCTTGTTggagcgacgaagacattGCTCGGAGCGTGGACTGTGCATCCCAACCATGA
ACAAGGTAAAACGGAGTGTCCTTTCTAGTTCCATTTTGTGAGTTGTTGATAGCGCAAATCAGTCGCTCTGCAATCTCGTCCCAGTCTTGCTGCAAAGGAT
CTTCGGCATAGACTCGTACAGATTGCATGACTGTCTTCACCGaccgttcctgctggccatTCGCTTGTGGCCGATAGCTCAGCGTCGTTCTCGACCGAGA
CTGCAGCATCTCGGCGAAGGTTTGGAAAACCTCGCTCATAGACCGAGGGTCACGGTCGTGGCGAATCAATGTTGGTGCTCCGAACCGTCGGTAGACACAC
TCTCCGAAAGCTTGTGCTACCTTCAGTGCAGTCGTATCGGACATTGCTTTGCCCATCACGAAACCGGTGAACGCACACTGGAACAGCAGTAGTGCCGTGT
TGTCACTGCGAGACTTCGGTAACGGTATGACGAAATCCATAGATACAATCTGGAACGGTCTTTCCGCCAGGATGTTCCCTGGTGAATAGCCTCGGAACTG
CGGCCGACTCTTGCTCAAACTGCAATCTGGGCAAGACTTCACATGTCGCTCCACGTCTGCATAGAGCCCGATCCAATAGTAGTCGGCTTTGACCCTGTGA
TAGGTCCGACCAATATCTTGGTGGTCGCCTTCCAGCGAGTCATGACAGCTCTGCAGTACCTCTTGAATCATCGCTGTAGGTACCACTAGACGCACCGTCG
TCTCTTCTTGCCGTTTGATGCCCCACCGACGGTTCACTCCGAGAAAATAGAGTACATCGTCTTCGCTGAGCACGAACTTGTCCGACATTTTTCATGCATC
TCTCGCCGCCTTGTAGCTGAGTTTCGTTTCTTCGCCTCGTAGCATCACTTTGAGGTTTGACCACCTcagttcttcatcttgagc