Description :
From Genome Similarity Track
Location :
Scaffold_3770:117- 1325
Transcript NameFunction/comments
Phypl_g16025reverse transcriptase

Sequence
1208 bases(100 bases per row)
TCGCGCTCTCCCACTCGCTTGATCTTCAGATGGTATGGAGATAGCAGTACAGCGAAACTCACCGCACGTCCATAAAGGGTCTTTGACGTGAACACCCATT
CCAACGTAGAGAAGCGGGTGTAGACATGGATAGTCTTCCCTGCTACCAGCGTATAGTTGATCTTCAAGAGTCGAAGCAGTGCCAGCACCTTTCTCTCGGC
TGGGTGGTTGTTGACCTCGTTTTCCTTGAGGACGCGACCACATAAGCGGACTGGATGCAGATTGCTGGCATGCATCTGCATCATGGTACTGCTGAGCGCC
CCGTCATTGGCAAATATCATCACATGGACCTCCTTCGCTGAGTCAAAGTGTCGTAGTGTCGGAGCTTCAATCATCTTACGCTTCAACTCGTCGAACGAAG
CACGGGGGGCAGTCAGGTCACCCCCGTCCGTGAAGTCATCTTCTTTGAGTTGATAGAGGACAGCCGCATACAAAGCCAAATTCTGAATGAACCGGCTATA
GTAGTTCAGGGCTCCAGGAATGCCTGCATGATTTTCTTCGACTTTGGAATGGTAATTCTGCGATGGCCGCCAGTTTCTTGGGATCAGCCGCAATACCTTG
CGCAGTTACCTTGTGCGATAGAAAGTCGACTTGTGGCTGGACAAAAATGCTCTTGGTAAAGCTCACACTGATCCTGCACTCAGCGAATCTTGTGAGCAGT
CGGTCCAACGTTGCCAGACACTCGTCGAAACTCGTTCCGCCGAAGCAAATATCGTCGACGAACGATCTACGTTCAAAAACTGGGATTATCTTCGACTCGT
TGGGTTCTCCTGAGCTGAACATATCGCTATCCGGGCTGTCGgtgagctcctggagcggGTCTGATTCGTCGAGCGCACGATAATCAGCGTCGAACTTCGT
CATAGGGCTCGCTGAGTCGTCGGGCCGAGCCAGTAGAGTGGGTTGGCCGGCTCGctgagcagctgcagcctctcaGCTCGCTGCACCTTCTCGGCGAACG
ACGTCCAGCCGCCTTTAGGCAGCACATATCCCCAGAGTGCATTATCGATGAGTCTTTGATATGCCACCGGCCCATTCTTGAGCCCGAAAAGCATgcgcag
ccactcgaagtGACCCAGGGCGCACACAAATGCTGAAATGTGTCTTGCTCGCCGAGTCATCATGACAGCCCAAATTCCACTGCCCGTATCGAGCGAGCAG
AACCAAAG