Description :
From Genome Similarity Track
Location :
Scaffold_2029:117- 1134
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_2029-abinit-gene-0.7HECT E3 ubiquitin ligase

Sequence
1017 bases(100 bases per row)
CTAGGACAAATCAAAGCCAGCGTTCGCCTTGATCGCGTACAGCAGCTTCTTGCGCATAATCTCCTTGTTCGAGTACGTCGGCAGCTTAAGCAAGTTCATG
CACGTCGCGCTGGACGGCAGCCGCTCGTCCTCGGTCGTGCGGACCTGGTGAATGCAGATCTGCGGGGCCAGTTGGCCAAAGCCGAGCAGTGGCTGGCGAG
AGCAACTGGTGATGAACTTGAGCAGCGCGGCGCGGTCCTCCATGTCAAACTCGAACCGTACAATATCCCAGAACCACTGGATCACGAGCTGCGACGGGTG
GTACCCGCCACCGTACATCGTGTGCTTCTCCCAGTCGTCAATGTCAATCTTGTTCGCCGAGCCGCCAATGAGCATCTGCAACTCGGCCGGACTAAACATC
TGGATCCACTTGGCTGGGATCAGGTCTCGAAAGCCCTTCAAAAACGCAGCGCTCTCACTGGACGACAGCACGTTCAGCTTGTAGTTGGCCATGACGTGGA
TGTACCGGATCCGGTTCTCGCTCGTCACGGGGACATTCGCGCCGTTCGGGATCAAGTTGCGCGTGACGACCTGGCCAAACTCCATCTCGCTCACGCTGAA
TGTCAGCGCCAGATCCTCCACGTTGCCCTGGTAGTGCTTGAGCTGCATCAGGCTTTTGTACAGTTCCGGATCGAGCGAGCGCAGGTCATCGATGTAGTTG
AACTTGCCAAGAAGCTTGTTCAGGAAAAACGCGGCAAACTGCGGCTCCACGAGGATGTTCTCGTACACCGCCTTCGCAAGCACGCGGCCGAGAAAACGGA
ATCGATCGAACACTTCTCTGCTCGAGTCTGCAAGAAGGCGAGCGGCAGGATTCGGGTACAGCAGTTGGTCTTCGGTCGCCAGGAAGTAGCCGTACTCTGG
AGAGAAGGCGCTCTTGTTCAGTGAGTCCATGTACTCTTTGAACACGCCGCCGCCGTCAATCCCAGCCTCTTCGAGACCCTGCTCGTTAATGAACGTCACC
TTGAACTTTGCCTTCAG