Description :
From Genome Similarity Track
Location :
contig_29:116984- 118138
Transcript NameFunction/comments
g6749.t1XP_002902049.1 conserved hypothetical protein [Phytophthora infestans T30-4

Sequence
1154 bases(100 bases per row)
AGGGTGAACAGACAGCGCAGCAGTGATTAGAGTTTGCAGCGCTGGACGAACCAAGCAACTTCAACATCCGTTATCGAGCACCGGCACCAGTAACGGTAAA
CTTAAGTTTTTTAGTGCATGCGCGTTCTGCTTGAGTCCTCCTCAATGTATTGCAGCGGGCGTCCTCGTCGCCGGCAGCCAACGCGGTAGCGCGCTATCGG
AGCTGCACCATTAGCTTCATCATATTGTAGGCAGGAGTTCACAACTTCAGCCACAACTTCAGTCTTCAGACTGTAGCCATCTGCTCGGATGAGTTCACGC
CAAACAATCATTTTTTGTATGAACTGGAACTGGAATTCAGAAGGCCTTGTCGCTCGCTACCTGGTGGCTGTCCCAGCAGCATGTCTTCTGCGAGAAGCAG
ACTCACACATCAGTAGCAGGCGATTGACATCCCGACCGCCACGGGGTAAGGAAAAAATAACCCATCAGATTTTAGACGTTCTAAATGATGTCCTTATTTA
TCAGTCCGCACACTAATAAGGTCCATGGAATCACACACTTCGTGTAGCTTATTATCTTAGTCGCGATATACTGCTCGCCGGTTATCAGTCGGGTGTATGC
CATTGCAACCTCCAGAGCTGCGATGAGGTCCTGTTTTTCATCCGTGAAGCGTGCTGGAGAGGTCGCAAGACGCGCAGTCCATTATTCAGGCGAGTCACGG
TACTCTCACATAATTTGGAATTGAATGCCACAACTTGATTACGGCTCTGGGTTGACTTCGCATTCCATTCAGCGTGCTGGATCTCACTTCAGTTTTGCCG
ACTTCCAGGGCGGAATCATCATGGTGAAGGTCGGCGAGGACGAGGACGAGGGAGACCAGGGCCTGACGACCAAGGACCAGAAGGCGACAACAGCAGCTGC
TGCAAACCCCATGAGTCCGCTCTCCTCGGAGGCGCTGATGCTGCGCGAGCTGGAGCTGGCGCCCGTCCTCATGTACCCGCAGCAGGTCTCGCGCGCCACC
GAGATCCGCCTCTTCCTCTCGCGCATCGAGTGCATCGCCATCCACCAGGTCATCGAGCGCGAGGAGGGCGTCGTCTACTTTGTGCTGGATGTGTACCGCT
ACCGCCTGCAAAAGGGGCTCCCGTGCACGCGCAGCCGCCGCCGCAAACTGTCGG