Description :
From Genome Similarity Track
Location :
contig_29:116982- 118136
Transcript NameFunction/comments
g7067.t1RAW26108.1 hypothetical protein PC110_g17482 [Phytophthora cactorum

Sequence
1154 bases(100 bases per row)
TCAGGCAGGGTGAACAGACAGCGCAGCAGTGATTAGAGTTTGCAGCGCTGGACGAACCAAGCAACTTCAACATCCGTTATCGAGCACCGGCACCAGTAAC
GGTAAACTTAAGTTTTTTAGTGCATGCGCGTTCTGCTTGAGTCCTCCTCAATGTATTGCAGCGGGCGTCCTCGTCGCCGGCAGCCAACGCGGTAGCGCGC
TATCGGAGCTGCACCATTAGCTTCATCATATTGTAGGCAGGAGTTCACAACTTCAGCCACAACTTCAGTCTTCAGACTGTAGCCATCTGCTCGGATGAGT
TCACGCCAAACAATCATTTTTTGTATGAACTGGAACTGGAATTCAGAAGGCCTTGTCGCTCGCTACCTGGTGGCTGTCCCAGCAGCATGTCTTCTGCGAG
AAACAGACTCACACATCAGTAGCAGGCGATTGACATCCCGACCGCCACGGGGTAAGGAAAAAATAACCCATCAGATTTTAGACGTTCTAAATGATGTCCT
TATTTATCAGTCCGCGCACTAATAAGGTCCATGGAATCACACACTTCGTGTAGCTTATTATCTTAGTCGCGATATACTGCTCGCCGGTTATCAGTCGGGT
GTATGCCATTGCAACCTCCAGAGCTGCGATGAGGTCCTGTTTTTCATCCGTGAAGCGTGCTGGAGAGGTCGCAAGACGCGCAGTCCATTATTCAGGCGAG
TCACGGTACTCTTACATAATTTGGAATTGAATGCCACAACTTGATTACGGCTCTGGGTTGACTTCGCATTCCATTCAGCGTGCTGGATCTCACTTCAGTT
TTGCCGACTTCCAGGGCGGAATCACCATGGCGAAGGTCGGCGAGGACGAAGACGAGGGAGACCAGGGCCTGACGACCAAGGACCAGAAGGCGACAACAGC
AGCTGCTGCAAACCCCATGAGTCCGCTCTCCTCGGAGGCGCTGATGCTGCGCGAGCTGGAGCTGGCGCCCGTCCTCATGTACCCGCAGCAGGTCTCGCGC
GCCACCGAGATCCGCCTCTTCCTCTCGCGCATCGAGTGCATCGCCATCCACCAGGTCATCGAGCGCGAGGAGGGCGTCGTCTACTTTGTGCTGGATGTGT
ACCGCTACCGCCTGCAAAAGGGGCTCCCGTGCACGCGCAGCCGCCGCCGCAAAC