Description :
From Genome Similarity Track
Location :
Scaffold_15:116972- 122548
Transcript NameFunction/comments
Physo_309127Hypothetical protein
Physo_567881phosphatidylinositol kinase (PIK-G2)

Sequence
5576 bases(100 bases per row)
TGGAATGGACGCCCAAATGTGCATATCCAGGATGTTCCCTGAAAACTCGAGCGACGGGCCGTCACTGCCATTGATTTGCTTGAGCACCACAGCATTCTGG
AAAATGAAGTAGAGTCCCGCCGTGTACGCTGGCTGGAGACTATGCTCGATGTACAAGTGGTTCTTCTCGATCTGGTTCAGATGTCGGTCGATATACACTA
GGCAATAGTCAGAGTCGATTTTGTATGCAGTGGACGATCCATCGGTGGTGTTGAAATTGCGCGGCAAGACAATCAGAGACGGCTTGGATTCAACTTCGAG
GGCCGCTCGGGGTTCATCTACCGTGGTCGCCAGCATTTTCCACTGTGAATCACTGATAGGAAACCAATTCCAGTTCAGATTTATCGGGCTTAGCAAACTC
ATTGGAATTCCACTTTCACTCACCAGCAAGTGGTCGTTCAGCAAGGTACCATTATTTCCCAGCGGAAATCGAATTCCTCTGCACCCATCGCCAGTCTTGC
ACTCGGCGTTGTACGTCTCTGAAAAGTTTTCCGGTCTCCACGCCAGACGCCCCACAGTAAGCGAGTACACCATGCGAGCATTCTCGACTGTGTTGCTTGA
ACTCACCAACGAGTCCCCTTCAATACGCTTCCCCAGACTAACAACCATCATGGACGTAGTCGAGCGCCGCGTACACGACTGCAGAATCTGCTCAAGACCC
GAATAGTCGTTGTCCACAACGAGGGTCTCTTCTCCTTGGTCGTTCAAACAAATGGCTAGTGCTTGTACGCGAGGGTGGATCGCCGTTGTGTTCCCATCCG
CCTTGTACTCTTCGTTGTCCGCCAACAGACACGCCTTCGTGTTGCATGCGTAAGAGTACAGGGGCCAATAGAATGGATTCGTGCTTGACGAGTTGTCTCT
CTGTGTACCGTACGTTCGGGTCGGAATTTCAATCGTCAGAGCATCAAAAACGATAGTTTCGGTCAAGTTTACACGCGTGAACTCCACTTTCGCCAACTCA
TCCGAAGTCCTGGAGAGCTCCGCTTTATCGTAGTAGTCAATGATTACCTGGCGGGCAGTAGAGGCGAAGTTCGCGTTGCCAGTCGAGCGAGTTGTCAAGT
TGAAATAATCTGCCAGAACAACTTTCCCCGTCGCGTTGGCGTGACTGAAACTACCCCAAGCCTCGTCCTCTTTCGTCCACCACCCAAGAAACGTGTTGCT
CACGACCAGCGAGTACACCACCAGGTTTGTTGCAATGGCTTTGCTCATCGGCAGGTCATCGTACTGCTCAAGGTCAGACTCCGCGGCATTCATGGGCATA
CTCAACGAAGCTGTCGGTTCTAGCGCTTTTGACAGTGCGTTCTGCTGCCAGGTTCGCGAAGGGAAGCCGTAGCTTGGCAACACATTCTTGAATGCTGTAG
CGTAATACCAATCATCAGTCTCTTTGCAGTGCGTCGGGACCTCCTCTCTCGGGATGAACAGACCACGCAGGATGGTGTTAAGTACACTGTTTCCAGGCGT
ACTCTCACGAAACTTTGGGTCCCATGTCGTCGTTAGATTCCCCTCGGCGTCCAGCTGTTGAGTATCATCGTGAACGCTCTCTACAACGAGATCTGACGGC
ATTATCCTTGGGCTCACCGCACCGGGAACCACTTGCAAGTTCATGGAGTTGAAACCCGTGTTCATCAGATAACCCACGACGCCGATGACACCGATCAAGA
GATATCTGCGTCGGCTTTCAAGATACGCACTCATTCTGGACGCGAGCATCAGGAAGATGACCGCTACCACCATGCTCAGAGTCACATCGAGTGGCTTCAT
CATCAGCGCCGTCAGACTGCCCAGTCTTTCGTTGTACTTGTCCAGAAGCTCTTTTCGTTCCCCTTCGTCCACGTCAATTGACCGAAAAGAGCCCACTTGC
ATCCCTTTCCCTGCAAATGGCAGCGTTACTCCAACAAAGAAGGCAGCCATCGCCACAGGGATCGCCACCGCGCGGAAACGAAGAATGGTCACATCGAGGG
TGTACTCCGAGGGAGACTTCCCTTCCAAGGGGAGTTCTGAAAGCTCGCTCGTCCGGTCCGTCTCGGTCTCAGTGTGCGATTCCCCCGCGGTGGTGGTCAT
CATCGCGGCTGCTCTGCAAAATGAACAATGAGTGAACAGCCACCGCAGCCAGACAGCCACACGTCCCCACTGCACCCACCGATCCCAAACGGATCGCGGC
CAAAATCAGGATCGCGGATGGCGACGCTACCGGAATTTCTGAGTACAGTTCAACCGACATCACTTCTGTTAGATGCTGAAACCAAAACCTTGCTTAACCT
CTGAGTCTTCGTTGCTCAACCACGTGGTTGCGGATTAGTTCAGCGTACTAAACGGATTAGCCCCACGTAGTTTGCTGGAACGGATTAATTCCGCGCAGAT
TATCAGGTGGCATGTCTCAAAAAATCACATCGAGGATTTGGCTGGGTTCGTGCACTTTGGACGCTGTTATTAGGCAGGGTGAAGCGAGAGCTGATGTAGC
TTAATGTACCATGATGCCTGTCACCAACGGTGCAGCTTCCGTCAGCTTCGGTTTGGTCATGTAAGTTGCTTACTGTTCAATTGTGACTGCTGATGTGGTG
ACTGGCCACACACAACAGGTTACGACCTGAGATGCACAGGCATCTACCTCTACTCCCGCATCGATCGTACGTCTCACCTCTATAATGCCACTGCATGGGT
CGCAGAGCCACTCGGCTAGCCAATAGCTAAACACTGGAGGTCGCAATTGGCGAAGGTTTTACATGTAAGGTCAGGGAGCCATTGGAGAGGCTCAAAACTG
CTCTCACCACTTCATCCGTTTTATTTTTGCTTAGCCGTAGGGGCTAGCGAAGGCATTGTTATAGTAACAGAGCGGGGTACCAAGCTCCCAGATGAGCCCT
ACGCGCAGGTAATCTCTGTATAAAACGCTACCTGCTGGTAATCCGAATGAATGATACACTCGGAAGTAATCCCTTTTCTACGTGGTTTTAATCCTCCCTC
TTCTTCCTTTACCATTCGGGTGGGGGCAGGAAGGGGGCCGAACGAGTTATAGGGGGTCAACCAAACGTTGAAGACTCACTCTACTAGAAAACAAAGTTGT
GCACAGTGTATTGGTGTTAACGGGCTTCAAGCCAAGGTTGGATCCACGATACCGCAATCAAGTTGGTTGCACCACCCCCAATCCAGGCATCAATCCAGGC
AGCCTCGGACGTCTTGAGATCTTCATGCTCCCGCTGGCTCGAATCCGGAAGCCGCCGTACGAGACCATGGGGTCATGGTTTTCCCGATCACAGTCGTCTA
TATACGAAAATCTGCCTTAACATTTTTTTTAAAAAAATAAACAATACTTCAAAGTATAATAATTTCCCTCATCCTTAAGTAGGGGCACGATTGGAAACTT
TGAAAGGGGTTTTTCGTTCTTTTTCACCCCTCCGAACCTGCACCCTAAAGCACAATTTGGGCCAATCGGAATCCTTCGGCGTCGTGTGTACGTCCAGCCA
CGGTCCGACACTCGACAATCGTCGCCTTGACGTTGTCGCGCTGAATCGAGACCCGCACTTCGCCTTCGTCCACGAGCGCAACAGCGGACGAAGCCCATAG
CCCCGCAAGCCTTTGTACCCACCTACCCACCTACCCACCTACTGCACCCGCTCCTCTGCAGTGTATGGCACAATGACCGAGGAGACGGAGGAGCCGCGGA
CGCCCGTGAACCCCTCGGACGCCAGCGAAGGATCGCGCAGTGAAGACGCCGCCGCCTCCAGCTGCGACCTGCAGTCCCCGTCCGCCACGTCCGCCCCGCC
GTCCACTTGCGCAGCGGACGCGGAGCGGCGCAGCTCCGCGCACTCCAGCGGGCCGCCCATGTCCGAGCCCTGCTCCTCCTCCGCCTCCATGGAGCTGCTG
GGGACGCTGGGCGTCGAGCGCGACGGACTGGGCGTCAAGGGCTACCTGAGCATGCGCGACGAGGGCGTGACGTACCACCGCATGAAGCGCTTCTACTGCC
GCTGCGTGGGCGTCAACTTCTACCGGTTCGCGTCCCGAGACGCGGCGTCCGCGCTCATCTCGGCGCTCTTCAGCGCCGAGGTGCAGAAGGTCGAGTCGTG
GGACGGCAAGGGCCTCTGGCACACGTACCGCCACTCGTTCAAGCTGTCGTTCACGTCCGGCGTCGTGTTTAACGTGGACGCGGACTCGGAGGAGGACAAG
CGGCAGTGGATCGAGTACATTGAGGCCGCGCTCAAGGGGACGGAGGATGCAGTCGCCAAGTGGAGCGCGCACGCCTCCGTGAGCCCGGACATCATGGATC
TCACCCCTGGGGGGCTCGTGTTTACGGAGAAGAAGTGCAGCCCGCCTAAGTTTAAGAACGACACGACGTGCTGCCACCCTGGCTGCCACGTACGATTCGA
CAGCACGGGAAAAAGACAGCATCACTGCCGGAACTGCGGTGGCTCGGTCTGCTCGGACCACAGCTCTCGGTTTGCAATGCTTCGGCACTTCCACATGAAC
CACCCGGTGCGGCTTTGCATGGGTTGTTACCGTGTGCAGCGCTTCGTGTTGTGGCTGGGGATGCTGCTCCAGCGGCTTAGTATCGCCCAGACGGAGGTGC
AAGGCGTCAAGAAACCTGCTTTGGCCAAGGCCGACGAAGAGGAGGTCGAGGCATTGCTCGCGATGTTTAGCGACGAGGTATTCGGCATCTCTGATGTCAT
TCAGGTGCTGCATTTGCATCGCCACGGATGCGACGAAGCGTACGCTTACGCCGTGAACAAGCTGCTGGAGCTGTCTGCATCCAACCTGGCCGATTTCGAG
TTTTTCCTGCCGCAGATATTCCACATGTGGCTCACGGTGGACTGGACGAACAACAATATCAAAGCTGCGCTGCTCTTCCGGGTCATCTGTTACGCGACGC
AGCTCCACATTCGACTTGCGACCGCCATCTACTGGCTGACACGCGCGGCGATCGACGATAGCTGTGGGTGGGGCTTCGGCCAGTCGGAGCTGTACGTTCC
CGAGTTCCTGTACCGGAAAATGAGCATGTGCAAGCTGCTGATGGTCAACGTGGAGATGCAGATTTCTCATGGCGACTGGTCTTTTGAAGTCGACAAGGAC
TTGCCGGCTTCGACGGAACAATCTGCCATCATCAAGTGCCTGTTTGACCGTCTCTTAATCCTCGTCCATACGGATACCAAGGCCACGATCCCGCTCGGTG
CAATATGCGATGCAGTTAGCGCCTGCTCCATTCCTCCGGATTTTTTACTGCCTAGCGACGCACTGCCCAACGATTCCCACCGCGACGATGGCGAAGAGCG
TCGGATCTTCACCACACAAATTAGCTTCATCGAAGAGCTGTGTGCGATGACAGAGAGACTGCGCTTTTGTGCTCCGCAGGAGCGTAAGAAGGCGCTACGA
CGCGAACTGCAGAAGCTTGAACTGCCTGAAGGAGCTTTCTGCCCGCTAGGATCGTGTGATGATCCACTTCAGCGGCTCCTTACGATTGCGAAGGAAGAAG
GAACAGTTTTTACGACCCGAGCGCGCGCGCCAACGTTAATTTTCTTCGAAGTTGCGAGGCTGATGACTATCTCCGA