Description :
From Genome Similarity Track
Location :
Scaffold_761:11697- 13488
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_761-snap-gene-0.9Mediator of DNA damage checkpoint protein 1

Sequence
1791 bases(100 bases per row)
TTGGGCAATGCGCAGTAATCGCGGAGCTAGGCTCGCGTCGTCCGGTCCTGGGTCTTCTTTGAACACTTTGCTCAGCACCTCGGCCAGCTCGATCATTGCG
TGGAACCTCGAGAGCGGGCGATTGACCAGGCTCGCCGTCGTCAATTTCTCAGCGGCCAGAAACTCGGCCAGGATACTTGCGCGGCCACTGTCGCCGCCAC
CACTGCCAGCGCCAAATTGGTTCAAGGCAGCCTCGATGGATTCACTCTTGCAGAAGATCTGCGCGTAAAGCACGCGAACAACTCTCAGCATGTCGTCGAG
GATGCTCACCAAGTCGCCGAAGGCACCATCGTCATGTTTGGACCTAGTCTTCTGGCAGCGTTCACACAATTGGTGCAACTTGCGCTGGAACAGCTCGTGG
TAGAAATGCAGATGCTTCTCGAGCTCGAGGAACTCCCACAGCCCGGCCAATCCATCACCTGCTGGAGCACATTCGAACCTCAGACGCTTGTGGACGCTCT
GCTCGAGACGCTCCAAGAAGCTCGTGTATTCGCGATCATCCGCGAGGAAGGCTTGGACCCCCGCCAGCACAGCGCTTCGAGTCACCTTCATTTTTGGCGC
GCCTCTCGCGCCAAAATCTCAGCCGTAACTACGCATTACCGTATTGTAATTGTGAAAACGAAATATTGGTTTAATATTCATCAAAATATAACCAAATGAA
GCAATTATTGCTGATTTCAGAAATTTGGCAAATCTGGCTGCATTTTGTCGGATTGATCAGGTCCGATTTGCACACCGGGAGTTCACGAAAAAAAAGGTGG
AGCAAACAATCCGATGGTAAAATCGGTACTGCTGACATGTAAATAGGACGAAAGACACATTGTGTCTGCACCGGATTGTGCGTATCGATGTGGGGACAAA
AGGCACACCTTCACAAAATAGATGTAAAAGAGTCATACTTGCGCACATCTTTTCGTGTTAAGTCACTAATCATTTGTTCATCCCGCAGCAATGGCGATTG
GAGAACTGCGTGATCTTTAGGAAGGCAAGCAATAAAATAATCATAGTGATACACCAACGAGACGACGACAAACTCGCCAATGCAAGATGCCGATTCGAGA
AAGTCAGGGAAACAAACAAACTTCACGGCATCAAGAGAAGCGGCCATAAATCGTGAGAGTATAGAGGCAAATTCAGCCTTCAGAATCGGGAGACCACTTA
TCGTACGACCCACAAACATGTCGCCAGCACCATGCCTCAAGTATCGGTCTTGGACTCCACCAAGAGCCCATTCAGCCCGCAGATAATCTGCTAATGTGGG
TCGACATCGAACTTCAGAGACGCGTGAAGTAGCTCACACTCATCTGCAAAGTCATTCTCTATCGTAATCTCTAAGGAAGGCAATGCGTCTCGGCGACCAA
GTCGAAAAGAATCATCAAAACGTCTTCAAGCTGCACCGGGCCGCTGGCGTTGAACCGCGTATTAACGCAGCGGTACGCTACATTGCTCTCCGGCGCTTGC
TGCAAATTAAGAACTAGAATTAGTTCGCCCTGAGTATACGATCAATATACGATCAAAGCATAAGAGACTCGTGAACGTACGTTTGTGTGGTTAGAGATGT
TGCCGAGGCGGACGAAATTGTTGCGAAAGTCGATTGGATTGGTGGTCTCCACCTGTGCGCGCAGCAATCCTGTGTCTTAATATACATTCATTAGAGCATA
CAGATTTGTAAGTGTTGGAACGAGCATGCACGCACGCTTCGTGAGAAAGCCAAACGGACGGATTACTTGCCCAATCGACGGTGTTTGGATT