Description :
From Genome Similarity Track
Location :
Scaffold_101:116966- 118151
Transcript NameFunction/comments
g15004.t1hypothetical protein

Sequence
1185 bases(100 bases per row)
CGGTTGAAGCACGTGTGCGCCCGCGGATACAAGCATTCGTCTGCGCTGACGCACTGGATCGCGAACGGGCAGATGCGTCCGTCATTCATGGTCAGCGCTT
TGAAGCCTTGTACTGGCACCCGCGCCGAGCCGGTTGTGAACTGCAGCAAGCGCGCCTTTTGCTCGTTCGTGAATTCATGGACGATATTCCAGAACCAGGC
GATAGCTCGCTCGTCGCGCTCCCCCACATAAATAGTGTGAGTCTTCCAGTCCTGCACGTCAATGTCGGGGATTCCACAAATCAAGAGCTCCAACTCCTGG
TGGTCGAAGACAGAGATAAGCTCCTTGGGAATAATTGAGAAGAGGCCCTGCATCAAGGATCCCAGCTGCTGCGATATGCTGTTTGCAACGATCCACTTGA
AGCGCAGGTTGACGTACTCCATCTTGTTCTCTTCAGTGACGGGGATGTTCGATCCGTTTGGTACCAAATCCACCACCTTCGCCTTGTCAGACATTTGGTC
GACGTTGACACTGGAAATGCACAAGACAATTTGTTAACATGACTGCAACTCAGTGGCTTGAAACAGAATACTACGTACGTGAAGTCCAGGGCCAATGATT
CTACACCCGTGTTGTCTCGCAACCACTTCAAATTCTTGTACAGGTCGTTGTCCACGAACTCCAAGTCCGAAAACGTAATGGGGATACCCAGAATATGCTT
GCATACCGGGAGTGCCAAGTGTGCATCGATGAGGATACCTTCGAAGAGCGCTCTACCGATGAAACGACCAATTGCTTGGTAGTACTGCACACACACACAA
ACAACTGTAAGAACACACCAACACATCGACAACTACCGCAAAGCGTACCATCAGGTGGTCAACACTGGCTTCAGCGGACGCAGGATTCACCATGAGTCCA
TCTCCGTTACCGCTTCTGTAGAACAGCCCAGTAGCATCATCGAAGACCTCCTTTGTCATCAGCGTAAACCATTCGCGGACCAGACCACCTGCATCCACGC
CCGGCTCGTTCGCGAACTTGATTCGAAGAGACTGGTGCAGCTGATCCGGGGTCGCCCATAAAAGCTGTTCGCACGAATTGTGGAGAAGGTTGTCACGCTC
GATCTCCAGCAACAAGTGCCCATACTCCCACGGAACCTCCATGGCAGCCGTGTGCTGCACAAACCACGCGTGCTTTTGCTGGAAG